Incidental Mutation 'R4302:Trip11'
ID 322464
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Name thyroid hormone receptor interactor 11
Synonyms 3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik
MMRRC Submission 041089-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4302 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 101800304-101879463 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101860027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 282 (D282E)
Ref Sequence ENSEMBL: ENSMUSP00000135669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
AlphaFold E9Q512
Predicted Effect probably damaging
Transcript: ENSMUST00000021605
AA Change: D283E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: D283E

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177183
AA Change: D27E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: D27E

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177536
AA Change: D282E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188
AA Change: D282E

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,540,279 (GRCm39) Y1445C probably damaging Het
Arhgef12 G A 9: 42,929,645 (GRCm39) Q217* probably null Het
Bcas1 A G 2: 170,260,547 (GRCm39) V44A probably benign Het
Cfap251 T C 5: 123,431,873 (GRCm39) I549T probably benign Het
Clic4 A G 4: 134,953,350 (GRCm39) V98A probably benign Het
Col6a3 A T 1: 90,735,336 (GRCm39) I771N probably damaging Het
Creb3l1 T C 2: 91,823,664 (GRCm39) I183V probably damaging Het
Dnhd1 T A 7: 105,343,161 (GRCm39) W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 (GRCm39) S2941T probably benign Het
Gm973 A G 1: 59,590,399 (GRCm39) Y302C possibly damaging Het
Hcfc1 A G X: 72,992,972 (GRCm39) S1398P probably benign Het
Igsf10 T C 3: 59,226,171 (GRCm39) I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Loxl4 T A 19: 42,596,030 (GRCm39) Y141F probably benign Het
Man2a2 T A 7: 80,001,487 (GRCm39) E1140V possibly damaging Het
Mgam A G 6: 40,740,019 (GRCm39) D1664G probably benign Het
Mill2 A T 7: 18,590,456 (GRCm39) T179S probably damaging Het
Ncf4 T C 15: 78,144,962 (GRCm39) probably benign Het
Nol12 T C 15: 78,824,341 (GRCm39) S154P probably damaging Het
Nup58 A G 14: 60,484,875 (GRCm39) S50P probably benign Het
Or11j4 T C 14: 50,630,903 (GRCm39) I230T probably benign Het
Or12d16-ps1 T A 17: 37,706,377 (GRCm39) N315K probably benign Het
Or7g30 A G 9: 19,352,295 (GRCm39) T29A probably benign Het
Pdss1 T C 2: 22,805,517 (GRCm39) I265T probably damaging Het
Piezo2 T C 18: 63,257,801 (GRCm39) probably null Het
Rad50 T A 11: 53,592,832 (GRCm39) N106I probably benign Het
Rhpn2 A G 7: 35,090,270 (GRCm39) T631A probably benign Het
Rps11 T C 7: 44,772,368 (GRCm39) M80V probably benign Het
Rrm1 T C 7: 102,097,031 (GRCm39) Y104H probably benign Het
Sgsm3 T A 15: 80,894,502 (GRCm39) probably benign Het
Slc9c1 A T 16: 45,365,154 (GRCm39) L162F probably benign Het
Son A G 16: 91,455,299 (GRCm39) T1349A possibly damaging Het
Stk24 A G 14: 121,529,494 (GRCm39) L386S probably benign Het
Tfcp2 G T 15: 100,412,730 (GRCm39) N307K possibly damaging Het
Trbv21 T A 6: 41,179,702 (GRCm39) V6D probably benign Het
Ttn G T 2: 76,706,811 (GRCm39) probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r38 A G 7: 9,100,562 (GRCm39) probably null Het
Vps8 T A 16: 21,314,664 (GRCm39) L158Q probably damaging Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101,852,406 (GRCm39) missense probably benign 0.37
IGL00484:Trip11 APN 12 101,851,570 (GRCm39) nonsense probably null
IGL00972:Trip11 APN 12 101,860,596 (GRCm39) missense probably null 1.00
IGL01476:Trip11 APN 12 101,865,170 (GRCm39) missense probably damaging 0.96
IGL01591:Trip11 APN 12 101,849,604 (GRCm39) missense probably damaging 0.98
IGL01667:Trip11 APN 12 101,845,121 (GRCm39) missense probably damaging 1.00
IGL01764:Trip11 APN 12 101,850,890 (GRCm39) missense probably damaging 1.00
IGL01789:Trip11 APN 12 101,838,090 (GRCm39) missense probably benign 0.05
IGL01814:Trip11 APN 12 101,850,747 (GRCm39) missense probably damaging 0.98
IGL01898:Trip11 APN 12 101,851,935 (GRCm39) missense probably benign
IGL01924:Trip11 APN 12 101,853,143 (GRCm39) missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101,850,572 (GRCm39) missense probably damaging 1.00
IGL02475:Trip11 APN 12 101,861,942 (GRCm39) missense probably benign 0.01
IGL02544:Trip11 APN 12 101,859,780 (GRCm39) missense probably damaging 1.00
IGL02678:Trip11 APN 12 101,849,649 (GRCm39) missense probably damaging 0.96
IGL02714:Trip11 APN 12 101,850,260 (GRCm39) missense probably damaging 1.00
IGL02718:Trip11 APN 12 101,852,284 (GRCm39) missense probably benign 0.24
IGL02904:Trip11 APN 12 101,853,097 (GRCm39) missense probably damaging 1.00
IGL03012:Trip11 APN 12 101,850,195 (GRCm39) missense probably damaging 1.00
IGL03191:Trip11 APN 12 101,865,184 (GRCm39) missense probably damaging 1.00
IGL03327:Trip11 APN 12 101,849,677 (GRCm39) missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101,851,278 (GRCm39) missense probably damaging 1.00
NA:Trip11 UTSW 12 101,860,580 (GRCm39) splice site probably null
R0027:Trip11 UTSW 12 101,851,428 (GRCm39) missense probably benign 0.00
R0028:Trip11 UTSW 12 101,851,016 (GRCm39) missense probably damaging 1.00
R0238:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0238:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0239:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0239:Trip11 UTSW 12 101,850,987 (GRCm39) missense probably damaging 1.00
R0505:Trip11 UTSW 12 101,851,931 (GRCm39) missense probably damaging 0.98
R0556:Trip11 UTSW 12 101,850,777 (GRCm39) nonsense probably null
R0573:Trip11 UTSW 12 101,853,119 (GRCm39) missense probably benign 0.02
R0626:Trip11 UTSW 12 101,852,235 (GRCm39) missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101,852,419 (GRCm39) missense probably benign 0.04
R1530:Trip11 UTSW 12 101,879,026 (GRCm39) missense unknown
R1647:Trip11 UTSW 12 101,850,651 (GRCm39) nonsense probably null
R1648:Trip11 UTSW 12 101,850,651 (GRCm39) nonsense probably null
R1856:Trip11 UTSW 12 101,849,592 (GRCm39) nonsense probably null
R2013:Trip11 UTSW 12 101,803,981 (GRCm39) missense probably damaging 1.00
R2017:Trip11 UTSW 12 101,851,619 (GRCm39) missense probably benign 0.00
R2206:Trip11 UTSW 12 101,839,701 (GRCm39) missense probably benign 0.25
R2207:Trip11 UTSW 12 101,839,701 (GRCm39) missense probably benign 0.25
R2304:Trip11 UTSW 12 101,865,236 (GRCm39) missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101,845,086 (GRCm39) makesense probably null
R2513:Trip11 UTSW 12 101,803,986 (GRCm39) missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101,859,953 (GRCm39) missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101,860,581 (GRCm39) nonsense probably null
R4124:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4126:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4128:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4175:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4176:Trip11 UTSW 12 101,861,957 (GRCm39) nonsense probably null
R4181:Trip11 UTSW 12 101,860,027 (GRCm39) missense probably damaging 1.00
R4296:Trip11 UTSW 12 101,852,127 (GRCm39) nonsense probably null
R4306:Trip11 UTSW 12 101,853,198 (GRCm39) missense probably benign
R4342:Trip11 UTSW 12 101,850,575 (GRCm39) missense probably damaging 1.00
R4576:Trip11 UTSW 12 101,852,499 (GRCm39) nonsense probably null
R4586:Trip11 UTSW 12 101,849,600 (GRCm39) missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101,803,875 (GRCm39) missense probably damaging 1.00
R4696:Trip11 UTSW 12 101,851,549 (GRCm39) missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101,851,705 (GRCm39) missense probably benign 0.10
R4903:Trip11 UTSW 12 101,853,065 (GRCm39) critical splice donor site probably null
R5001:Trip11 UTSW 12 101,851,169 (GRCm39) nonsense probably null
R5017:Trip11 UTSW 12 101,812,879 (GRCm39) missense probably benign 0.00
R5227:Trip11 UTSW 12 101,851,179 (GRCm39) missense probably damaging 1.00
R5231:Trip11 UTSW 12 101,851,860 (GRCm39) missense probably damaging 0.96
R5539:Trip11 UTSW 12 101,851,386 (GRCm39) missense probably damaging 0.98
R5754:Trip11 UTSW 12 101,851,924 (GRCm39) nonsense probably null
R5755:Trip11 UTSW 12 101,851,924 (GRCm39) nonsense probably null
R5890:Trip11 UTSW 12 101,852,231 (GRCm39) missense probably damaging 0.99
R5910:Trip11 UTSW 12 101,849,738 (GRCm39) missense probably damaging 1.00
R6083:Trip11 UTSW 12 101,856,001 (GRCm39) missense probably benign 0.00
R6208:Trip11 UTSW 12 101,865,154 (GRCm39) missense probably damaging 1.00
R6216:Trip11 UTSW 12 101,856,859 (GRCm39) missense probably benign 0.31
R6315:Trip11 UTSW 12 101,851,837 (GRCm39) missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101,851,790 (GRCm39) missense probably benign 0.12
R6590:Trip11 UTSW 12 101,851,710 (GRCm39) missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101,851,710 (GRCm39) missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101,812,879 (GRCm39) missense probably benign 0.00
R6938:Trip11 UTSW 12 101,803,886 (GRCm39) missense probably damaging 0.98
R7015:Trip11 UTSW 12 101,859,942 (GRCm39) missense probably damaging 1.00
R7023:Trip11 UTSW 12 101,852,126 (GRCm39) missense probably benign 0.13
R7133:Trip11 UTSW 12 101,850,329 (GRCm39) missense probably damaging 0.97
R7271:Trip11 UTSW 12 101,850,611 (GRCm39) missense probably damaging 1.00
R7424:Trip11 UTSW 12 101,851,457 (GRCm39) missense probably damaging 1.00
R7431:Trip11 UTSW 12 101,850,278 (GRCm39) missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101,851,639 (GRCm39) missense probably benign 0.00
R7491:Trip11 UTSW 12 101,851,694 (GRCm39) missense probably damaging 1.00
R7752:Trip11 UTSW 12 101,853,233 (GRCm39) missense probably benign 0.01
R7763:Trip11 UTSW 12 101,811,114 (GRCm39) missense probably benign 0.03
R7779:Trip11 UTSW 12 101,849,796 (GRCm39) missense probably damaging 0.97
R7844:Trip11 UTSW 12 101,844,403 (GRCm39) missense probably damaging 1.00
R8055:Trip11 UTSW 12 101,803,924 (GRCm39) missense probably damaging 1.00
R8076:Trip11 UTSW 12 101,849,741 (GRCm39) missense probably damaging 1.00
R8288:Trip11 UTSW 12 101,860,643 (GRCm39) missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101,811,160 (GRCm39) missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101,879,063 (GRCm39) missense unknown
R8690:Trip11 UTSW 12 101,839,656 (GRCm39) missense possibly damaging 0.76
R8879:Trip11 UTSW 12 101,828,857 (GRCm39) missense probably benign 0.00
R8964:Trip11 UTSW 12 101,811,315 (GRCm39) critical splice donor site probably null
R9005:Trip11 UTSW 12 101,845,131 (GRCm39) missense probably benign 0.02
R9013:Trip11 UTSW 12 101,851,377 (GRCm39) missense probably damaging 0.99
R9020:Trip11 UTSW 12 101,850,770 (GRCm39) missense possibly damaging 0.91
R9041:Trip11 UTSW 12 101,845,127 (GRCm39) missense probably benign 0.06
R9234:Trip11 UTSW 12 101,811,990 (GRCm39) critical splice donor site probably null
R9447:Trip11 UTSW 12 101,850,148 (GRCm39) missense probably damaging 1.00
R9631:Trip11 UTSW 12 101,859,807 (GRCm39) missense probably benign
R9641:Trip11 UTSW 12 101,859,957 (GRCm39) nonsense probably null
R9691:Trip11 UTSW 12 101,850,123 (GRCm39) missense probably benign 0.00
R9751:Trip11 UTSW 12 101,850,765 (GRCm39) missense possibly damaging 0.54
X0020:Trip11 UTSW 12 101,852,172 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAAGCGCTCACACTGCTC -3'
(R):5'- TTGTTTGCTGGTAACACTACAGC -3'

Sequencing Primer
(F):5'- GCTCACACTGCTCAGTCATC -3'
(R):5'- GTTGTCCAGGTTCTAAACAC -3'
Posted On 2015-06-20