Incidental Mutation 'R4303:Ift80'
ID 322485
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Name intraflagellar transport 80
Synonyms 4921524P20Rik, Wdr56
MMRRC Submission 041090-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R4303 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 68799832-68911903 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68801507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 744 (I744T)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
AlphaFold Q8K057
Predicted Effect probably benign
Transcript: ENSMUST00000029347
AA Change: I744T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: I744T

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107812
AA Change: I744T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: I744T

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136448
Predicted Effect probably benign
Transcript: ENSMUST00000169064
AA Change: I744T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: I744T

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,606,055 (GRCm39) S247P probably damaging Het
Atg4b A G 1: 93,695,984 (GRCm39) E41G probably benign Het
Bckdk T C 7: 127,504,502 (GRCm39) probably benign Het
Cacna2d1 A G 5: 16,507,246 (GRCm39) probably null Het
Chaf1a A G 17: 56,351,068 (GRCm39) D16G unknown Het
Defb12 A G 8: 19,162,737 (GRCm39) I65T probably benign Het
Dnah7c T C 1: 46,787,738 (GRCm39) Y3264H probably damaging Het
Ehhadh C A 16: 21,581,602 (GRCm39) K463N probably damaging Het
Ehmt2 G A 17: 35,127,724 (GRCm39) R901Q possibly damaging Het
Entrep1 G A 19: 23,952,993 (GRCm39) A439V probably damaging Het
Entrep1 C T 19: 23,953,002 (GRCm39) S436N probably damaging Het
Ern2 T C 7: 121,777,069 (GRCm39) probably null Het
Esp6 A G 17: 40,876,035 (GRCm39) T28A possibly damaging Het
Gm17333 A C 16: 77,649,767 (GRCm39) noncoding transcript Het
Heatr5a T C 12: 52,003,008 (GRCm39) T165A probably benign Het
Hoxa5 T C 6: 52,181,240 (GRCm39) S31G probably benign Het
Kalrn T C 16: 34,055,761 (GRCm39) K853E probably damaging Het
Krt36 A T 11: 99,994,239 (GRCm39) D279E possibly damaging Het
Map3k11 T A 19: 5,740,852 (GRCm39) V193E probably damaging Het
Mrgpra4 T A 7: 47,630,684 (GRCm39) M306L probably benign Het
Myo1a A G 10: 127,549,602 (GRCm39) T428A probably benign Het
Nuggc A G 14: 65,848,621 (GRCm39) H174R possibly damaging Het
Or14c40 G A 7: 86,313,163 (GRCm39) V98M probably benign Het
Or1e29 A T 11: 73,667,664 (GRCm39) M163K possibly damaging Het
Pigr G A 1: 130,769,554 (GRCm39) D122N probably benign Het
Pik3ca C T 3: 32,494,084 (GRCm39) R349* probably null Het
Rfxank T C 8: 70,588,862 (GRCm39) D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Serpina1a A G 12: 103,820,934 (GRCm39) L348P probably damaging Het
Shank1 A G 7: 43,991,898 (GRCm39) Y701C unknown Het
Six4 G T 12: 73,159,314 (GRCm39) D207E possibly damaging Het
Slco3a1 G T 7: 74,204,276 (GRCm39) D21E probably benign Het
Sox6 C T 7: 115,143,704 (GRCm39) probably null Het
Spta1 A G 1: 174,007,418 (GRCm39) N216S probably damaging Het
Stard13 T C 5: 150,986,334 (GRCm39) N392S possibly damaging Het
Tax1bp1 T C 6: 52,704,263 (GRCm39) V81A possibly damaging Het
Trim29 G T 9: 43,222,419 (GRCm39) V83L probably damaging Het
Vmn1r90 C T 7: 14,295,495 (GRCm39) W201* probably null Het
Wdr31 T A 4: 62,378,626 (GRCm39) N7I probably damaging Het
Ypel4 A G 2: 84,567,151 (GRCm39) probably benign Het
Zfp39 T C 11: 58,780,843 (GRCm39) K640E probably damaging Het
Zfp579 A G 7: 4,996,072 (GRCm39) probably benign Het
Zfp974 C A 7: 27,609,657 (GRCm39) K689N possibly damaging Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68,821,986 (GRCm39) nonsense probably null
IGL01020:Ift80 APN 3 68,871,012 (GRCm39) missense probably damaging 1.00
IGL01544:Ift80 APN 3 68,898,115 (GRCm39) missense probably benign 0.05
IGL01612:Ift80 APN 3 68,870,996 (GRCm39) missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68,869,629 (GRCm39) missense probably benign 0.00
IGL02187:Ift80 APN 3 68,892,789 (GRCm39) missense probably damaging 1.00
IGL02381:Ift80 APN 3 68,869,653 (GRCm39) splice site probably null
IGL02407:Ift80 APN 3 68,805,869 (GRCm39) missense probably benign
IGL02510:Ift80 APN 3 68,805,876 (GRCm39) missense probably benign 0.07
IGL02512:Ift80 APN 3 68,835,058 (GRCm39) critical splice donor site probably null
R0091:Ift80 UTSW 3 68,822,008 (GRCm39) missense probably damaging 1.00
R0212:Ift80 UTSW 3 68,847,506 (GRCm39) missense probably benign 0.05
R0348:Ift80 UTSW 3 68,843,232 (GRCm39) missense probably benign
R0357:Ift80 UTSW 3 68,821,986 (GRCm39) nonsense probably null
R1381:Ift80 UTSW 3 68,822,116 (GRCm39) missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68,847,531 (GRCm39) missense probably damaging 1.00
R1643:Ift80 UTSW 3 68,823,490 (GRCm39) missense probably benign 0.06
R1899:Ift80 UTSW 3 68,825,846 (GRCm39) missense probably benign 0.00
R1926:Ift80 UTSW 3 68,823,498 (GRCm39) missense probably damaging 1.00
R2013:Ift80 UTSW 3 68,898,117 (GRCm39) missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68,825,332 (GRCm39) missense probably damaging 1.00
R4214:Ift80 UTSW 3 68,898,141 (GRCm39) missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68,871,023 (GRCm39) missense probably damaging 0.96
R4361:Ift80 UTSW 3 68,870,982 (GRCm39) missense probably damaging 1.00
R4576:Ift80 UTSW 3 68,857,863 (GRCm39) missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68,898,092 (GRCm39) missense probably benign 0.01
R4652:Ift80 UTSW 3 68,822,273 (GRCm39) missense probably benign 0.32
R4654:Ift80 UTSW 3 68,825,870 (GRCm39) missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68,869,623 (GRCm39) missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68,898,092 (GRCm39) missense probably benign 0.01
R4885:Ift80 UTSW 3 68,857,829 (GRCm39) missense probably damaging 0.98
R5357:Ift80 UTSW 3 68,898,113 (GRCm39) missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68,875,196 (GRCm39) missense probably benign 0.00
R5589:Ift80 UTSW 3 68,838,233 (GRCm39) missense probably damaging 1.00
R5806:Ift80 UTSW 3 68,857,809 (GRCm39) missense probably benign 0.09
R6910:Ift80 UTSW 3 68,835,068 (GRCm39) missense probably benign 0.01
R6962:Ift80 UTSW 3 68,901,878 (GRCm39) start gained probably benign
R7157:Ift80 UTSW 3 68,898,277 (GRCm39) nonsense probably null
R7452:Ift80 UTSW 3 68,901,615 (GRCm39) splice site probably null
R7504:Ift80 UTSW 3 68,825,338 (GRCm39) missense probably damaging 0.99
R8077:Ift80 UTSW 3 68,823,478 (GRCm39) missense probably benign 0.01
R8435:Ift80 UTSW 3 68,892,787 (GRCm39) missense probably damaging 1.00
R8821:Ift80 UTSW 3 68,869,583 (GRCm39) missense probably damaging 0.98
R8831:Ift80 UTSW 3 68,869,583 (GRCm39) missense probably damaging 0.98
R8897:Ift80 UTSW 3 68,857,809 (GRCm39) missense probably benign
R9222:Ift80 UTSW 3 68,825,894 (GRCm39) missense possibly damaging 0.58
R9328:Ift80 UTSW 3 68,847,483 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTAACCTTTCTGAACGTACC -3'
(R):5'- TCAAAGGTAGCTCATAGGGTTTC -3'

Sequencing Primer
(F):5'- CTCATGTATGCTAGGCAAGTGCAC -3'
(R):5'- AGCTCATAGGGTTTCAGCGTTAC -3'
Posted On 2015-06-20