Incidental Mutation 'R4303:Stard13'
ID322489
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151062869 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 392 (N392S)
Ref Sequence ENSEMBL: ENSMUSP00000053232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062015
AA Change: N392S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: N392S

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110483
AA Change: N392S

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: N392S

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect possibly damaging
Transcript: ENSMUST00000202111
AA Change: N274S

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: N274S

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202385
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGATACTGACACGGCTGGC -3'
(R):5'- TGCTCCAGTAAGTCAAGTGG -3'

Sequencing Primer
(F):5'- ACACGGCTGGCCCTGTG -3'
(R):5'- TCAAGTGGTGAGAGCAGCCC -3'
Posted On2015-06-20