Mutagenetix > Incidental Mutation

Incidental Mutation 'R4259:Sgo2b'

322566

Institutional Source

Beutler Lab

Gene Symbol

Sgo2b

Ensembl Gene

ENSMUSG00000094443

Gene Name

shugoshin 2B

Synonyms

Gm4975, Sgol2b

MMRRC Submission

041072-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R4259 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64377728-64405204 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64381330 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 501 (F501I)

Ref Sequence

ENSEMBL: ENSMUSP00000136323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179944]

AlphaFold

J3QMK1

Predicted Effect

probably benign
Transcript: ENSMUST00000179944
AA Change: F501I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: F501I

Domain	Start	End	E-Value	Type
coiled coil region	54	113	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	400	414	N/A	INTRINSIC
internal_repeat_1	528	618	9.12e-8	PROSPERO
internal_repeat_1	713	809	9.12e-8	PROSPERO
low complexity region	1009	1024	N/A	INTRINSIC
low complexity region	1059	1081	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1130	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210915

Meta Mutation Damage Score

0.1685

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 9,214,066 (GRCm39)	S298P	probably damaging	Het
4930407I10Rik	A	G	15: 81,947,927 (GRCm39)	D608G	possibly damaging	Het
Actr10	T	C	12: 70,999,759 (GRCm39)	V185A	probably benign	Het
Cd248	A	G	19: 5,118,866 (GRCm39)	D238G	probably damaging	Het
Cep290	A	C	10: 100,350,354 (GRCm39)	E649D	probably damaging	Het
Cyp2b19	G	A	7: 26,462,807 (GRCm39)	G230S	probably damaging	Het
Dnah12	A	G	14: 26,520,883 (GRCm39)	I1901V	probably benign	Het
Garin1b	C	G	6: 29,320,800 (GRCm39)	I141M	probably damaging	Het
Gpr171	A	G	3: 59,004,948 (GRCm39)	S276P	probably damaging	Het
Hap1	C	A	11: 100,242,668 (GRCm39)		probably null	Het
Hcn1	A	T	13: 118,111,884 (GRCm39)	K616M	unknown	Het
Igkv4-90	T	C	6: 68,784,461 (GRCm39)	I18M	possibly damaging	Het
Itpr3	T	A	17: 27,325,298 (GRCm39)	V1297E	probably damaging	Het
Kmt2b	T	C	7: 30,280,506 (GRCm39)	N1319D	probably damaging	Het
Krt72	T	C	15: 101,686,692 (GRCm39)	E418G	probably damaging	Het
Lama1	T	C	17: 68,059,413 (GRCm39)	S599P	possibly damaging	Het
Llgl1	C	T	11: 60,600,394 (GRCm39)	P581L	probably benign	Het
Lrrk1	A	T	7: 65,980,512 (GRCm39)	Y223N	probably damaging	Het
Or5p57	T	A	7: 107,665,100 (GRCm39)	K272*	probably null	Het
Or8g50	A	T	9: 39,648,999 (GRCm39)	D296V	probably damaging	Het
Or8k30	A	G	2: 86,339,343 (GRCm39)	D180G	probably damaging	Het
Pde6c	G	A	19: 38,151,293 (GRCm39)	G608S	probably damaging	Het
Pdgfrb	A	C	18: 61,210,703 (GRCm39)	T737P	probably benign	Het
Pdk2	T	C	11: 94,931,970 (GRCm39)	D38G	probably benign	Het
Pgk2	T	G	17: 40,518,274 (GRCm39)	T385P	probably benign	Het
Prl3b1	T	C	13: 27,427,889 (GRCm39)		probably null	Het
Sat1	T	C	X: 153,998,182 (GRCm39)		probably benign	Het
Sgsm2	T	A	11: 74,782,854 (GRCm39)	H34L	probably damaging	Het
Slc26a1	T	A	5: 108,820,496 (GRCm39)	K250N	probably damaging	Het
Slc38a4	A	G	15: 96,896,374 (GRCm39)	Y498H	probably damaging	Het
Slc5a4b	A	G	10: 75,939,686 (GRCm39)	L150P	probably damaging	Het
Tbc1d32	A	G	10: 55,925,867 (GRCm39)	S1093P	probably damaging	Het

Other mutations in Sgo2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sgo2b	APN	8	64,379,557 (GRCm39)	missense	probably benign
IGL01343:Sgo2b	APN	8	64,380,349 (GRCm39)	nonsense	probably null
IGL02027:Sgo2b	APN	8	64,379,863 (GRCm39)	missense	probably benign
IGL02090:Sgo2b	APN	8	64,380,123 (GRCm39)	missense	probably damaging	0.99
IGL02121:Sgo2b	APN	8	64,384,316 (GRCm39)	missense	possibly damaging	0.94
IGL02206:Sgo2b	APN	8	64,394,118 (GRCm39)	missense	possibly damaging	0.94
IGL02554:Sgo2b	APN	8	64,379,571 (GRCm39)	missense	probably damaging	0.96
IGL02663:Sgo2b	APN	8	64,396,148 (GRCm39)	missense	probably damaging	0.97
IGL03149:Sgo2b	APN	8	64,379,617 (GRCm39)	missense	probably benign	0.14
floater	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0201:Sgo2b	UTSW	8	64,379,670 (GRCm39)	missense	probably benign
R0285:Sgo2b	UTSW	8	64,381,823 (GRCm39)	nonsense	probably null
R0325:Sgo2b	UTSW	8	64,381,410 (GRCm39)	missense	probably benign	0.20
R0727:Sgo2b	UTSW	8	64,380,816 (GRCm39)	missense	probably damaging	0.98
R0943:Sgo2b	UTSW	8	64,384,369 (GRCm39)	missense	possibly damaging	0.82
R1148:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1266:Sgo2b	UTSW	8	64,381,455 (GRCm39)	missense	probably benign	0.00
R1484:Sgo2b	UTSW	8	64,384,507 (GRCm39)	missense	possibly damaging	0.77
R1493:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1537:Sgo2b	UTSW	8	64,379,536 (GRCm39)	missense	possibly damaging	0.94
R1630:Sgo2b	UTSW	8	64,380,831 (GRCm39)	missense	possibly damaging	0.90
R1803:Sgo2b	UTSW	8	64,380,426 (GRCm39)	missense	probably benign	0.01
R1912:Sgo2b	UTSW	8	64,384,503 (GRCm39)	missense	probably damaging	0.98
R1993:Sgo2b	UTSW	8	64,379,867 (GRCm39)	missense	probably benign	0.36
R2042:Sgo2b	UTSW	8	64,381,561 (GRCm39)	missense	probably benign
R2130:Sgo2b	UTSW	8	64,380,181 (GRCm39)	missense	probably benign	0.09
R2146:Sgo2b	UTSW	8	64,381,057 (GRCm39)	missense	probably benign	0.00
R2881:Sgo2b	UTSW	8	64,380,570 (GRCm39)	missense	probably damaging	0.99
R3686:Sgo2b	UTSW	8	64,384,361 (GRCm39)	missense	probably benign	0.20
R3706:Sgo2b	UTSW	8	64,381,179 (GRCm39)	missense	probably damaging	0.98
R3889:Sgo2b	UTSW	8	64,380,777 (GRCm39)	missense	possibly damaging	0.82
R3894:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R3895:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R4058:Sgo2b	UTSW	8	64,379,981 (GRCm39)	missense	probably damaging	0.98
R4260:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4704:Sgo2b	UTSW	8	64,380,824 (GRCm39)	missense	probably damaging	0.98
R4815:Sgo2b	UTSW	8	64,384,448 (GRCm39)	missense	probably benign
R4922:Sgo2b	UTSW	8	64,379,664 (GRCm39)	missense	possibly damaging	0.66
R5232:Sgo2b	UTSW	8	64,381,636 (GRCm39)	missense	possibly damaging	0.55
R5262:Sgo2b	UTSW	8	64,396,171 (GRCm39)	missense	probably damaging	0.99
R5444:Sgo2b	UTSW	8	64,379,590 (GRCm39)	missense	possibly damaging	0.90
R5677:Sgo2b	UTSW	8	64,380,008 (GRCm39)	missense	possibly damaging	0.77
R5959:Sgo2b	UTSW	8	64,380,322 (GRCm39)	missense	probably benign	0.01
R6004:Sgo2b	UTSW	8	64,379,707 (GRCm39)	nonsense	probably null
R6267:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6296:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6328:Sgo2b	UTSW	8	64,381,345 (GRCm39)	nonsense	probably null
R6517:Sgo2b	UTSW	8	64,384,528 (GRCm39)	missense	probably damaging	0.99
R6523:Sgo2b	UTSW	8	64,380,538 (GRCm39)	missense	probably benign	0.11
R6726:Sgo2b	UTSW	8	64,380,769 (GRCm39)	nonsense	probably null
R6957:Sgo2b	UTSW	8	64,384,489 (GRCm39)	small deletion	probably benign
R7031:Sgo2b	UTSW	8	64,393,078 (GRCm39)	missense	possibly damaging	0.94
R7034:Sgo2b	UTSW	8	64,379,868 (GRCm39)	missense	probably benign	0.36
R7145:Sgo2b	UTSW	8	64,381,218 (GRCm39)	missense	probably damaging	1.00
R7289:Sgo2b	UTSW	8	64,394,192 (GRCm39)	missense	probably damaging	0.97
R7366:Sgo2b	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R7660:Sgo2b	UTSW	8	64,393,108 (GRCm39)	missense	probably benign	0.27
R7761:Sgo2b	UTSW	8	64,379,946 (GRCm39)	missense	probably benign
R7762:Sgo2b	UTSW	8	64,379,531 (GRCm39)	missense	probably benign	0.03
R7822:Sgo2b	UTSW	8	64,380,318 (GRCm39)	missense	probably damaging	0.98
R8111:Sgo2b	UTSW	8	64,396,138 (GRCm39)	missense	probably damaging	0.98
R8129:Sgo2b	UTSW	8	64,381,834 (GRCm39)	missense	possibly damaging	0.90
R8273:Sgo2b	UTSW	8	64,377,735 (GRCm39)	missense	unknown
R8856:Sgo2b	UTSW	8	64,393,091 (GRCm39)	missense	probably null	0.99
R9249:Sgo2b	UTSW	8	64,391,407 (GRCm39)	nonsense	probably null
R9428:Sgo2b	UTSW	8	64,393,067 (GRCm39)	missense	probably damaging	0.99
R9616:Sgo2b	UTSW	8	64,380,274 (GRCm39)	missense	probably benign
R9621:Sgo2b	UTSW	8	64,380,651 (GRCm39)	missense	probably damaging	0.99
RF014:Sgo2b	UTSW	8	64,384,439 (GRCm39)	missense	possibly damaging	0.94
RF055:Sgo2b	UTSW	8	64,396,203 (GRCm39)	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	64,381,456 (GRCm39)	missense	possibly damaging	0.61
Z1088:Sgo2b	UTSW	8	64,380,039 (GRCm39)	missense	probably damaging	1.00
Z1177:Sgo2b	UTSW	8	64,381,419 (GRCm39)	missense	possibly damaging	0.82
Z1177:Sgo2b	UTSW	8	64,380,473 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCCCAATGTTGTCTGAGCC -3'
(R):5'- GAGCCAAACTGTATTTCCAGTACTG -3'

Sequencing Primer
(F):5'- TGAGCCTCATGGTCACATAC -3'
(R):5'- ACTGTATTTCCAGTACTGAGCAGC -3'

Posted On

2015-06-20