Incidental Mutation 'R4259:Krt72'
ID322581
Institutional Source Beutler Lab
Gene Symbol Krt72
Ensembl Gene ENSMUSG00000056605
Gene Namekeratin 72
SynonymsKrt72-ps, K6irs2
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101776172-101786460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101778257 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 418 (E418G)
Ref Sequence ENSEMBL: ENSMUSP00000065922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071104]
Predicted Effect probably damaging
Transcript: ENSMUST00000071104
AA Change: E418G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065922
Gene: ENSMUSG00000056605
AA Change: E418G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 59 130 3.1e-17 PFAM
Filament 133 446 6.9e-157 SMART
low complexity region 454 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 507 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127671
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This gene encodes a type II keratin that is specifically expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q12-q13. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Krt72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Krt72 APN 15 101784999 missense probably damaging 0.99
IGL00568:Krt72 APN 15 101781015 missense probably damaging 1.00
IGL00966:Krt72 APN 15 101780961 missense probably damaging 1.00
IGL01997:Krt72 APN 15 101784880 missense probably damaging 0.99
IGL02858:Krt72 APN 15 101782121 missense probably damaging 1.00
IGL03260:Krt72 APN 15 101778273 missense probably damaging 1.00
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0601:Krt72 UTSW 15 101786056 missense probably damaging 1.00
R0669:Krt72 UTSW 15 101778305 missense probably damaging 0.99
R1396:Krt72 UTSW 15 101786005 critical splice donor site probably null
R1501:Krt72 UTSW 15 101778334 missense probably damaging 1.00
R1598:Krt72 UTSW 15 101780253 missense probably benign 0.00
R1779:Krt72 UTSW 15 101780929 missense probably benign
R1796:Krt72 UTSW 15 101781552 splice site probably null
R4835:Krt72 UTSW 15 101781073 splice site probably null
R4871:Krt72 UTSW 15 101786034 missense probably damaging 1.00
R6246:Krt72 UTSW 15 101780937 missense probably damaging 1.00
R6513:Krt72 UTSW 15 101776752 critical splice acceptor site probably null
R6520:Krt72 UTSW 15 101781046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCGCACTTGCCATATGATTTC -3'
(R):5'- TTTGTCAGCATCAGTGGAGGAG -3'

Sequencing Primer
(F):5'- GCCATATGATTTCACTTCAGTGGAGC -3'
(R):5'- GGCTGAGCAAGATTTCAGACCC -3'
Posted On2015-06-20