Incidental Mutation 'R4261:Adam9'
ID322654
Institutional Source Beutler Lab
Gene Symbol Adam9
Ensembl Gene ENSMUSG00000031555
Gene Namea disintegrin and metallopeptidase domain 9 (meltrin gamma)
SynonymsMDC9, MDC9, Mltng, Mltng
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24949611-25016927 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 24964907 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 733 (Q733*)
Ref Sequence ENSEMBL: ENSMUSP00000146545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000208247]
Predicted Effect probably null
Transcript: ENSMUST00000084032
AA Change: Q733*
SMART Domains Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: Q733*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 163 8.5e-36 PFAM
Pfam:Reprolysin_5 210 386 5.5e-20 PFAM
Pfam:Reprolysin_4 210 402 1.4e-11 PFAM
Pfam:Reprolysin 212 406 1e-67 PFAM
Pfam:Reprolysin_2 232 396 1.1e-12 PFAM
Pfam:Reprolysin_3 236 358 8.1e-19 PFAM
DISIN 423 499 8.7e-44 SMART
ACR 500 637 9.7e-75 SMART
EGF 643 674 9.9e-2 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 787 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084035
AA Change: Q733*
SMART Domains Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: Q733*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 163 8.1e-31 PFAM
Pfam:Reprolysin_5 210 386 5.8e-22 PFAM
Pfam:Reprolysin_4 210 402 1.6e-13 PFAM
Pfam:Reprolysin 212 406 1.9e-73 PFAM
Pfam:Reprolysin_2 232 396 9.4e-15 PFAM
Pfam:Reprolysin_3 236 358 3.4e-19 PFAM
DISIN 423 499 1.71e-41 SMART
ACR 500 637 2.86e-72 SMART
EGF 643 674 2.03e1 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 794 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 831 839 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208247
AA Change: Q733*
Meta Mutation Damage Score 0.6 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Adam9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Adam9 APN 8 24967196 missense probably benign 0.03
IGL01786:Adam9 APN 8 24996839 missense probably damaging 1.00
IGL02095:Adam9 APN 8 24996729 missense probably benign 0.00
IGL02322:Adam9 APN 8 24955974 missense probably damaging 1.00
IGL02555:Adam9 APN 8 24966736 missense probably damaging 1.00
IGL02869:Adam9 APN 8 24970618 missense probably damaging 1.00
R0126:Adam9 UTSW 8 24970737 missense probably damaging 1.00
R0448:Adam9 UTSW 8 24964910 missense probably damaging 1.00
R0552:Adam9 UTSW 8 24963010 missense probably benign 0.00
R0730:Adam9 UTSW 8 24996758 missense probably benign 0.02
R1455:Adam9 UTSW 8 24993109 missense probably benign 0.00
R1974:Adam9 UTSW 8 24992224 missense probably damaging 1.00
R2043:Adam9 UTSW 8 24996653 critical splice donor site probably null
R2054:Adam9 UTSW 8 24991294 missense probably damaging 1.00
R2091:Adam9 UTSW 8 24995184 splice site probably benign
R2111:Adam9 UTSW 8 24982126 splice site probably benign
R4852:Adam9 UTSW 8 25003301 missense probably damaging 1.00
R5165:Adam9 UTSW 8 24967174 missense possibly damaging 0.88
R6022:Adam9 UTSW 8 25003305 missense possibly damaging 0.87
R6101:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6105:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6415:Adam9 UTSW 8 24978482 missense probably damaging 1.00
R7241:Adam9 UTSW 8 24950986 missense possibly damaging 0.53
R7442:Adam9 UTSW 8 24967207 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCTAAGCCACCAGTCTTTC -3'
(R):5'- GACAGCTAATGTAACTGCCCATC -3'

Sequencing Primer
(F):5'- GGTTGTCCAATAGATAGTCCAGAC -3'
(R):5'- AATGTAACTGCCCATCACTGTC -3'
Posted On2015-06-20