Incidental Mutation 'R4261:Rfx7'
ID322659
Institutional Source Beutler Lab
Gene Symbol Rfx7
Ensembl Gene ENSMUSG00000037674
Gene Nameregulatory factor X, 7
Synonyms9930116O05Rik, D130086K05Rik, 2510005N23Rik, Rfxdc2
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72532240-72622937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72616643 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 372 (R372W)
Ref Sequence ENSEMBL: ENSMUSP00000127192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093820] [ENSMUST00000163401] [ENSMUST00000183372] [ENSMUST00000184015]
Predicted Effect probably damaging
Transcript: ENSMUST00000093820
AA Change: R372W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091338
Gene: ENSMUSG00000037674
AA Change: R372W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 101 185 3.1e-39 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163401
AA Change: R372W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127192
Gene: ENSMUSG00000037674
AA Change: R372W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 105 183 2.9e-33 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183372
SMART Domains Protein: ENSMUSP00000139195
Gene: ENSMUSG00000037674

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183601
Predicted Effect probably benign
Transcript: ENSMUST00000184015
SMART Domains Protein: ENSMUSP00000138957
Gene: ENSMUSG00000037674

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185013
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RFX7 is a member of the regulatory factor X (RFX) family of transcription factors (see RFX1, MIM 600006) (Aftab et al., 2008 [PubMed 18673564]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Rfx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rfx7 APN 9 72607690 missense probably damaging 1.00
IGL00323:Rfx7 APN 9 72617420 missense probably damaging 0.97
IGL00920:Rfx7 APN 9 72593356 missense probably damaging 1.00
IGL01317:Rfx7 APN 9 72618536 missense probably damaging 0.98
IGL01405:Rfx7 APN 9 72610344 missense probably benign 0.02
IGL01585:Rfx7 APN 9 72617061 missense probably benign 0.41
IGL02118:Rfx7 APN 9 72617204 missense probably benign
IGL02205:Rfx7 APN 9 72607650 missense probably damaging 1.00
IGL02608:Rfx7 APN 9 72617294 missense probably benign 0.00
IGL02629:Rfx7 APN 9 72619259 missense probably damaging 0.96
IGL02963:Rfx7 APN 9 72617616 missense probably benign 0.00
IGL03026:Rfx7 APN 9 72619685 missense probably damaging 1.00
IGL03033:Rfx7 APN 9 72532989 splice site probably benign
IGL03212:Rfx7 APN 9 72619161 missense probably benign 0.06
IGL03221:Rfx7 APN 9 72618806 missense probably damaging 0.99
PIT4431001:Rfx7 UTSW 9 72617971 missense probably benign
R0365:Rfx7 UTSW 9 72619836 missense probably benign 0.15
R0449:Rfx7 UTSW 9 72610304 critical splice acceptor site probably null
R0464:Rfx7 UTSW 9 72618204 missense probably damaging 1.00
R0746:Rfx7 UTSW 9 72619106 missense probably benign 0.00
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1263:Rfx7 UTSW 9 72577047 missense possibly damaging 0.79
R1277:Rfx7 UTSW 9 72593312 missense probably benign 0.32
R1330:Rfx7 UTSW 9 72617265 missense probably benign 0.00
R1371:Rfx7 UTSW 9 72619575 missense probably damaging 1.00
R1605:Rfx7 UTSW 9 72611789 missense probably damaging 1.00
R1802:Rfx7 UTSW 9 72619637 missense possibly damaging 0.50
R1903:Rfx7 UTSW 9 72616811 missense probably damaging 1.00
R2018:Rfx7 UTSW 9 72617685 missense probably benign 0.01
R2050:Rfx7 UTSW 9 72617466 missense probably benign 0.01
R2190:Rfx7 UTSW 9 72617919 missense probably benign 0.00
R2208:Rfx7 UTSW 9 72617964 missense probably benign 0.00
R2921:Rfx7 UTSW 9 72617664 missense possibly damaging 0.63
R3978:Rfx7 UTSW 9 72615111 missense possibly damaging 0.80
R4231:Rfx7 UTSW 9 72619390 missense possibly damaging 0.77
R4243:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4244:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4245:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4844:Rfx7 UTSW 9 72593242 nonsense probably null
R4902:Rfx7 UTSW 9 72617291 missense probably benign 0.05
R5432:Rfx7 UTSW 9 72593302 missense probably benign 0.35
R5627:Rfx7 UTSW 9 72532784 start gained probably benign
R5900:Rfx7 UTSW 9 72617256 missense probably benign
R5991:Rfx7 UTSW 9 72619538 missense possibly damaging 0.54
R6273:Rfx7 UTSW 9 72616997 missense possibly damaging 0.47
R6306:Rfx7 UTSW 9 72616955 missense possibly damaging 0.63
R6324:Rfx7 UTSW 9 72618414 missense probably damaging 1.00
R6437:Rfx7 UTSW 9 72618486 missense possibly damaging 0.66
R6860:Rfx7 UTSW 9 72616944 missense probably damaging 1.00
R6998:Rfx7 UTSW 9 72618505 missense probably damaging 1.00
R7255:Rfx7 UTSW 9 72619828 missense possibly damaging 0.77
R7336:Rfx7 UTSW 9 72593357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTAACGTCTTTAACCCAC -3'
(R):5'- AAGATCTGAGGGTAGCGGTGTC -3'

Sequencing Primer
(F):5'- GTAACGTCTTTAACCCACTCATTAG -3'
(R):5'- TAGCGGTGTCTGGCAGAAC -3'
Posted On2015-06-20