Incidental Mutation 'R4261:Dlgap5'
ID322668
Institutional Source Beutler Lab
Gene Symbol Dlgap5
Ensembl Gene ENSMUSG00000037544
Gene NameDLG associated protein 5
SynonymsDlg7, C86398, Hurp
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location47387779-47418407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 47413788 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 96 (Y96S)
Ref Sequence ENSEMBL: ENSMUSP00000153953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043296] [ENSMUST00000178661] [ENSMUST00000180299]
Predicted Effect probably damaging
Transcript: ENSMUST00000043296
AA Change: Y96S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040416
Gene: ENSMUSG00000037544
AA Change: Y96S

DomainStartEndE-ValueType
coiled coil region 86 116 N/A INTRINSIC
Pfam:GKAP 327 590 2.2e-38 PFAM
low complexity region 735 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111778
SMART Domains Protein: ENSMUSP00000107408
Gene: ENSMUSG00000037544

DomainStartEndE-ValueType
Pfam:GKAP 78 303 3.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178661
AA Change: Y96S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179392
Predicted Effect probably damaging
Transcript: ENSMUST00000180299
AA Change: Y96S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display female infertility resulting from a defect in decidualization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Dlgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Dlgap5 APN 14 47398468 missense probably damaging 1.00
IGL01110:Dlgap5 APN 14 47394326 splice site probably benign
IGL02943:Dlgap5 APN 14 47412976 critical splice donor site probably null
PIT4453001:Dlgap5 UTSW 14 47401522 frame shift probably null
R0189:Dlgap5 UTSW 14 47412975 splice site probably null
R0383:Dlgap5 UTSW 14 47410361 missense probably benign 0.01
R1078:Dlgap5 UTSW 14 47399566 missense probably damaging 1.00
R1915:Dlgap5 UTSW 14 47407773 missense probably benign 0.00
R1959:Dlgap5 UTSW 14 47416386 missense possibly damaging 0.88
R2051:Dlgap5 UTSW 14 47411484 missense probably benign 0.01
R2145:Dlgap5 UTSW 14 47395923 nonsense probably null
R2922:Dlgap5 UTSW 14 47390441 critical splice donor site probably null
R4607:Dlgap5 UTSW 14 47413018 missense possibly damaging 0.87
R4724:Dlgap5 UTSW 14 47401520 critical splice donor site probably null
R4898:Dlgap5 UTSW 14 47413819 missense probably benign 0.01
R5135:Dlgap5 UTSW 14 47399665 missense probably damaging 1.00
R5154:Dlgap5 UTSW 14 47413720 missense probably damaging 1.00
R5650:Dlgap5 UTSW 14 47411739 missense probably benign 0.01
R5849:Dlgap5 UTSW 14 47389435 missense possibly damaging 0.95
R5958:Dlgap5 UTSW 14 47413754 missense probably damaging 1.00
R6845:Dlgap5 UTSW 14 47416563 missense possibly damaging 0.79
R7163:Dlgap5 UTSW 14 47399638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAGTTAAAAGAATTGTTTGTCT -3'
(R):5'- GAGCGGATGAAGTCATGCATAATAT -3'

Sequencing Primer
(F):5'- GTCTGTGACAAGAAAGCC -3'
(R):5'- GCATGACTAGAACTCAAAATCACTG -3'
Posted On2015-06-20