Incidental Mutation 'R4261:1700010I14Rik'
ID322675
Institutional Source Beutler Lab
Gene Symbol 1700010I14Rik
Ensembl Gene ENSMUSG00000023873
Gene NameRIKEN cDNA 1700010I14 gene
Synonyms
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8988333-9008319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8995234 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 298 (S298P)
Ref Sequence ENSEMBL: ENSMUSP00000118841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024650] [ENSMUST00000151609]
Predicted Effect probably damaging
Transcript: ENSMUST00000024650
AA Change: S298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024650
Gene: ENSMUSG00000023873
AA Change: S298P

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
Pfam:TSNAXIP1_N 239 349 6.1e-36 PFAM
low complexity region 351 364 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
low complexity region 501 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136954
Predicted Effect probably damaging
Transcript: ENSMUST00000151609
AA Change: S298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118841
Gene: ENSMUSG00000023873
AA Change: S298P

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
coiled coil region 321 370 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in 1700010I14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:1700010I14Rik APN 17 8997105 critical splice donor site probably null
IGL01569:1700010I14Rik APN 17 8996995 missense probably benign 0.33
IGL03024:1700010I14Rik APN 17 8993632 missense probably benign 0.33
IGL03410:1700010I14Rik APN 17 9001896 missense probably damaging 1.00
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0324:1700010I14Rik UTSW 17 9001157 missense probably benign 0.33
R0361:1700010I14Rik UTSW 17 8992546 missense probably benign 0.39
R0482:1700010I14Rik UTSW 17 8988423 critical splice donor site probably null
R0529:1700010I14Rik UTSW 17 8992396 missense probably benign 0.32
R1102:1700010I14Rik UTSW 17 8992628 missense probably damaging 1.00
R1964:1700010I14Rik UTSW 17 8992492 missense probably damaging 0.99
R3620:1700010I14Rik UTSW 17 9008032 missense probably benign 0.15
R4259:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4687:1700010I14Rik UTSW 17 8992153 missense probably damaging 1.00
R4707:1700010I14Rik UTSW 17 9005712 missense probably damaging 1.00
R4839:1700010I14Rik UTSW 17 9008013 missense probably benign 0.41
R4979:1700010I14Rik UTSW 17 9001811 missense probably damaging 1.00
R5225:1700010I14Rik UTSW 17 9008007 nonsense probably null
R5383:1700010I14Rik UTSW 17 8992700 missense possibly damaging 0.86
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6505:1700010I14Rik UTSW 17 9001940 missense probably benign 0.08
R6736:1700010I14Rik UTSW 17 8992268 missense probably benign 0.01
R7089:1700010I14Rik UTSW 17 9008095 missense probably benign 0.00
R7097:1700010I14Rik UTSW 17 9005220 missense probably damaging 1.00
R7292:1700010I14Rik UTSW 17 8997029 nonsense probably null
R7405:1700010I14Rik UTSW 17 9001817 missense probably damaging 0.99
R7567:1700010I14Rik UTSW 17 9008006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCATGCGATTTATTCCTGTGG -3'
(R):5'- TATAGGCCAGATCCTCACCTG -3'

Sequencing Primer
(F):5'- TCTAGCCAGTCTATGAGCAGACATG -3'
(R):5'- CACCTGGAGAACTTCATATAAGAATC -3'
Posted On2015-06-20