Incidental Mutation 'R4261:Pgk2'
ID322677
Institutional Source Beutler Lab
Gene Symbol Pgk2
Ensembl Gene ENSMUSG00000031233
Gene Namephosphoglycerate kinase 2
SynonymsTcp-2, Tcp-2, Pgk-2
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40207018-40208609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40207383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 385 (T385P)
Ref Sequence ENSEMBL: ENSMUSP00000033585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033585]
PDB Structure
Crystal Structure of Phosphoglycerate Kinase-2 [X-RAY DIFFRACTION]
Crystal Structure of Phosphoglycerate Kinase-2 bound to 3-phosphoglycerate [X-RAY DIFFRACTION]
Crystal structure of phosphoglycerate kinase-2 bound to atp and 3pg [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033585
AA Change: T385P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033585
Gene: ENSMUSG00000031233
AA Change: T385P

DomainStartEndE-ValueType
Pfam:PGK 9 406 1.3e-152 PFAM
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility associated with reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Pgk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0195:Pgk2 UTSW 17 40207731 missense probably benign 0.01
R1297:Pgk2 UTSW 17 40208364 missense probably benign 0.04
R1351:Pgk2 UTSW 17 40207800 missense probably damaging 1.00
R1781:Pgk2 UTSW 17 40208507 missense probably benign 0.20
R2126:Pgk2 UTSW 17 40207509 missense probably damaging 1.00
R3153:Pgk2 UTSW 17 40208243 missense probably damaging 0.99
R3154:Pgk2 UTSW 17 40208243 missense probably damaging 0.99
R4152:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4153:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4154:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4259:Pgk2 UTSW 17 40207383 missense probably benign 0.01
R4812:Pgk2 UTSW 17 40207390 missense possibly damaging 0.56
R4961:Pgk2 UTSW 17 40207521 missense probably damaging 1.00
R4989:Pgk2 UTSW 17 40207511 missense probably damaging 1.00
R5661:Pgk2 UTSW 17 40207396 nonsense probably null
R6246:Pgk2 UTSW 17 40207424 missense probably damaging 1.00
R6415:Pgk2 UTSW 17 40207568 missense probably benign 0.00
R7054:Pgk2 UTSW 17 40208475 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTAGCTCATTACCTGGGTCTTG -3'
(R):5'- GCTCAAATTGTGGCCCAAGC -3'

Sequencing Primer
(F):5'- ACCTGGGTCTTGATTCATAGTAGAG -3'
(R):5'- CCCAAGCAAAGCTGATAGTTTG -3'
Posted On2015-06-20