Incidental Mutation 'R4276:Spag16'
ID322686
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 69873481 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably benign
Transcript: ENSMUST00000065425
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113940
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161131
SMART Domains Protein: ENSMUSP00000124372
Gene: ENSMUSG00000053153

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190833
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGAAAATGCTGACCTCTTTGG -3'
(R):5'- CAAAGCTCACATTTTAACCATCCTG -3'

Sequencing Primer
(F):5'- AGGCAGTCAAAGCTACCTG -3'
(R):5'- GGCTGGATATTTTCTTCTAACTGTAC -3'
Posted On2015-06-20