Incidental Mutation 'R0001:Ciita'
ID32270
Institutional Source Beutler Lab
Gene Symbol Ciita
Ensembl Gene ENSMUSG00000022504
Gene Nameclass II transactivator
SynonymsC2ta, Gm9475
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R0001 (G1)
Quality Score153
Status Validated
Chromosome16
Chromosomal Location10480059-10528418 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 10514433 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023147] [ENSMUST00000184863] [ENSMUST00000230146] [ENSMUST00000230395] [ENSMUST00000230450]
Predicted Effect probably benign
Transcript: ENSMUST00000023147
SMART Domains Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504

DomainStartEndE-ValueType
low complexity region 216 230 N/A INTRINSIC
Pfam:NACHT 362 533 1.8e-44 PFAM
low complexity region 847 861 N/A INTRINSIC
LRR 931 961 8.53e0 SMART
LRR 962 989 7.37e-4 SMART
LRR 991 1018 1.25e-6 SMART
LRR 1019 1046 2.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184863
SMART Domains Protein: ENSMUSP00000139108
Gene: ENSMUSG00000038055

DomainStartEndE-ValueType
Pfam:Dexa_ind 1 95 4.6e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229906
Predicted Effect probably benign
Transcript: ENSMUST00000230146
Predicted Effect probably benign
Transcript: ENSMUST00000230395
Predicted Effect probably benign
Transcript: ENSMUST00000230450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230533
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Ciita
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Ciita APN 16 10510727 missense probably damaging 0.99
IGL01830:Ciita APN 16 10521051 missense probably damaging 1.00
IGL02557:Ciita APN 16 10512015 missense probably damaging 1.00
IGL02634:Ciita APN 16 10508713 missense probably damaging 1.00
IGL03057:Ciita APN 16 10520959 splice site probably benign
IGL03403:Ciita APN 16 10503872 missense probably damaging 1.00
sisal UTSW 16 10513288 critical splice donor site probably null
R0138:Ciita UTSW 16 10512270 missense probably damaging 1.00
R0583:Ciita UTSW 16 10523804 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R2017:Ciita UTSW 16 10511676 missense probably damaging 1.00
R2072:Ciita UTSW 16 10518353 missense probably benign 0.16
R2410:Ciita UTSW 16 10510704 missense probably damaging 0.99
R4779:Ciita UTSW 16 10511366 missense probably damaging 1.00
R5151:Ciita UTSW 16 10523730 missense probably damaging 1.00
R5233:Ciita UTSW 16 10509401 missense possibly damaging 0.95
R5363:Ciita UTSW 16 10512167 missense probably damaging 1.00
R5431:Ciita UTSW 16 10523792 missense probably damaging 1.00
R5821:Ciita UTSW 16 10511805 missense possibly damaging 0.77
R6085:Ciita UTSW 16 10512165 missense probably benign 0.08
R6088:Ciita UTSW 16 10511931 missense probably damaging 1.00
R6241:Ciita UTSW 16 10511903 missense probably damaging 1.00
R6354:Ciita UTSW 16 10523746 missense probably damaging 1.00
R6502:Ciita UTSW 16 10511910 missense probably damaging 1.00
R6553:Ciita UTSW 16 10511745 missense probably benign 0.00
R6585:Ciita UTSW 16 10511745 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATGAGTCAGACACAGATAGAACCC -3'
(R):5'- GCTCACCTTGTCACTGCCCCAA -3'

Sequencing Primer
(F):5'- tttatcatcctcctgcctcatc -3'
(R):5'- TTGTCACTGCCCCAAGATCAG -3'
Posted On2013-05-09