Incidental Mutation 'R4279:Vnn1'
ID 322808
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Name vanin 1
Synonyms V-1, pantetheinase
MMRRC Submission 041079-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R4279 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 23770586-23781241 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23774410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 151 (D151V)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
AlphaFold Q9Z0K8
Predicted Effect possibly damaging
Transcript: ENSMUST00000041416
AA Change: D151V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: D151V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,269,637 (GRCm39) L1250Q probably damaging Het
Ccdc73 A T 2: 104,815,355 (GRCm39) N364Y possibly damaging Het
Ccl25 T A 8: 4,399,829 (GRCm39) L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,966 (GRCm39) A871E probably damaging Het
Cyp2b23 C T 7: 26,365,452 (GRCm39) S461N possibly damaging Het
Dgat2 C A 7: 98,813,912 (GRCm39) G120V probably damaging Het
Dsp A T 13: 38,369,207 (GRCm39) I768F probably damaging Het
Dzank1 T C 2: 144,333,765 (GRCm39) E356G probably benign Het
Fam120a A T 13: 49,042,734 (GRCm39) V889D probably benign Het
Fxyd5 C A 7: 30,734,811 (GRCm39) D139Y probably null Het
Gcnt2 T C 13: 41,041,666 (GRCm39) V275A probably benign Het
Gimap4 A G 6: 48,667,511 (GRCm39) I89V probably benign Het
Gm6578 G A 6: 12,100,187 (GRCm39) noncoding transcript Het
Jmjd8 A G 17: 26,048,787 (GRCm39) probably benign Het
Jmy G C 13: 93,635,390 (GRCm39) P142R probably damaging Het
Jmy C A 13: 93,635,781 (GRCm39) D12Y probably damaging Het
Kif13b G T 14: 65,016,805 (GRCm39) A1324S probably damaging Het
Klhl31 T C 9: 77,563,121 (GRCm39) S629P unknown Het
Lpar1 A G 4: 58,487,115 (GRCm39) V52A possibly damaging Het
Lrp5 A G 19: 3,641,778 (GRCm39) S1395P possibly damaging Het
Mogs T C 6: 83,093,048 (GRCm39) L132P probably damaging Het
Ncam1 C A 9: 49,418,259 (GRCm39) probably benign Het
Ndufs8 A T 19: 3,961,014 (GRCm39) F88I probably damaging Het
Nos2 T A 11: 78,820,602 (GRCm39) L69Q probably benign Het
Or51a6 T A 7: 102,604,292 (GRCm39) Q179L probably benign Het
Pls3 A T X: 74,846,138 (GRCm39) I192N probably benign Het
Psmd6 T C 14: 14,112,297 (GRCm38) N388S possibly damaging Het
Rrbp1 T C 2: 143,805,028 (GRCm39) T1046A probably benign Het
Scn11a T C 9: 119,583,428 (GRCm39) E1729G probably benign Het
Slc6a3 A G 13: 73,692,953 (GRCm39) D191G possibly damaging Het
Slc9a1 T C 4: 133,139,400 (GRCm39) F206S probably benign Het
Tmc5 A G 7: 118,273,886 (GRCm39) *968W probably null Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Unc13a T C 8: 72,119,311 (GRCm39) K9R probably damaging Het
Vegfa A G 17: 46,342,392 (GRCm39) V142A probably benign Het
Vmn1r119 T A 7: 20,745,786 (GRCm39) M199L probably benign Het
Zfp365 A T 10: 67,733,431 (GRCm39) F254I probably benign Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23,776,677 (GRCm39) missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23,770,949 (GRCm39) missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23,776,738 (GRCm39) missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23,776,608 (GRCm39) missense probably benign 0.26
IGL01970:Vnn1 APN 10 23,773,300 (GRCm39) missense probably benign 0.06
IGL01985:Vnn1 APN 10 23,776,642 (GRCm39) missense probably benign 0.00
IGL02019:Vnn1 APN 10 23,779,449 (GRCm39) missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23,779,323 (GRCm39) missense probably benign 0.00
IGL02349:Vnn1 APN 10 23,774,401 (GRCm39) missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23,780,520 (GRCm39) missense probably benign 0.00
IGL03058:Vnn1 APN 10 23,780,442 (GRCm39) missense probably benign 0.06
R0008:Vnn1 UTSW 10 23,774,500 (GRCm39) critical splice donor site probably null
R0030:Vnn1 UTSW 10 23,776,744 (GRCm39) missense probably benign 0.08
R0508:Vnn1 UTSW 10 23,770,910 (GRCm39) missense probably benign 0.01
R0781:Vnn1 UTSW 10 23,775,499 (GRCm39) missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23,775,499 (GRCm39) missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23,776,727 (GRCm39) missense probably benign 0.00
R1757:Vnn1 UTSW 10 23,776,726 (GRCm39) missense possibly damaging 0.49
R1778:Vnn1 UTSW 10 23,775,415 (GRCm39) missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23,770,869 (GRCm39) nonsense probably null
R2055:Vnn1 UTSW 10 23,776,475 (GRCm39) splice site probably benign
R2158:Vnn1 UTSW 10 23,776,653 (GRCm39) nonsense probably null
R2186:Vnn1 UTSW 10 23,773,299 (GRCm39) missense probably benign 0.29
R4277:Vnn1 UTSW 10 23,774,410 (GRCm39) missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23,770,789 (GRCm39) missense probably benign
R4590:Vnn1 UTSW 10 23,775,303 (GRCm39) missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23,773,250 (GRCm39) missense probably benign 0.01
R4794:Vnn1 UTSW 10 23,776,602 (GRCm39) missense probably benign 0.01
R5266:Vnn1 UTSW 10 23,779,303 (GRCm39) missense probably damaging 1.00
R5495:Vnn1 UTSW 10 23,774,462 (GRCm39) missense probably damaging 0.98
R6064:Vnn1 UTSW 10 23,770,807 (GRCm39) missense probably benign 0.05
R7081:Vnn1 UTSW 10 23,770,903 (GRCm39) missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23,776,645 (GRCm39) missense probably benign 0.00
R7221:Vnn1 UTSW 10 23,770,952 (GRCm39) missense probably benign 0.07
R7334:Vnn1 UTSW 10 23,776,658 (GRCm39) missense probably benign 0.04
R8784:Vnn1 UTSW 10 23,780,526 (GRCm39) missense probably benign
R8859:Vnn1 UTSW 10 23,780,484 (GRCm39) missense probably benign 0.01
R8926:Vnn1 UTSW 10 23,776,587 (GRCm39) missense probably benign 0.04
R8987:Vnn1 UTSW 10 23,776,714 (GRCm39) missense probably damaging 0.98
R9002:Vnn1 UTSW 10 23,775,349 (GRCm39) missense possibly damaging 0.82
R9091:Vnn1 UTSW 10 23,780,464 (GRCm39) missense probably damaging 1.00
R9270:Vnn1 UTSW 10 23,780,464 (GRCm39) missense probably damaging 1.00
R9276:Vnn1 UTSW 10 23,776,794 (GRCm39) missense probably damaging 1.00
R9453:Vnn1 UTSW 10 23,776,723 (GRCm39) missense probably damaging 0.96
R9557:Vnn1 UTSW 10 23,776,723 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACTATTGGCGTCCTTTGAAG -3'
(R):5'- AAATACTGCCCTCTCTGCTG -3'

Sequencing Primer
(F):5'- GCGTCCTTTGAAGCCTTTTG -3'
(R):5'- TGCTGTCACCACTCCACTCTAAAG -3'
Posted On 2015-06-20