Incidental Mutation 'R0003:Tpp2'
ID32281
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
MMRRC Submission 038299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R0003 (G1)
Quality Score211
Status Validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43960139 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 358 (S358T)
Ref Sequence ENSEMBL: ENSMUSP00000140474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087933
AA Change: S358T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: S358T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186028
Predicted Effect possibly damaging
Transcript: ENSMUST00000188302
AA Change: S358T

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763
AA Change: S358T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188313
AA Change: S358T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: S358T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000189388
AA Change: S358T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: S358T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190401
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,578 V1903E possibly damaging Het
Adam19 T A 11: 46,128,789 C439S probably damaging Het
Adnp2 T C 18: 80,130,990 Y68C probably damaging Het
Ahctf1 A T 1: 179,763,473 D1247E probably benign Het
Alms1 T A 6: 85,629,210 M2614K possibly damaging Het
Alx3 A G 3: 107,604,976 H310R probably damaging Het
Ambra1 C T 2: 91,911,428 T1016M probably damaging Het
Ankrd35 A G 3: 96,684,015 E539G probably damaging Het
Aptx A G 4: 40,695,145 probably benign Het
Arsi C T 18: 60,916,986 R314C probably benign Het
Atp1a3 T C 7: 24,989,564 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
BC067074 T A 13: 113,368,776 S2146R probably benign Het
Bicra G T 7: 15,971,887 T1543K probably benign Het
Bzw2 A C 12: 36,130,015 I71S probably damaging Het
Camk2a C T 18: 60,960,007 A302V probably damaging Het
Ccdc12 A G 9: 110,656,597 E12G possibly damaging Het
Cd300lb A T 11: 114,928,338 F19Y probably benign Het
Clcn3 A T 8: 60,927,296 C535* probably null Het
Cntnap5c A G 17: 58,199,017 T679A probably benign Het
Cpsf7 G A 19: 10,539,629 S365N possibly damaging Het
Cyp20a1 T C 1: 60,387,126 probably benign Het
Decr2 A T 17: 26,083,053 N234K probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dnah12 T C 14: 26,772,644 F1300L probably damaging Het
Dock1 T C 7: 134,730,064 probably benign Het
Dpy19l4 A T 4: 11,267,619 N440K probably damaging Het
Eprs T C 1: 185,414,391 V1206A probably damaging Het
Exoc6b A G 6: 84,854,699 probably null Het
Fam184b A G 5: 45,555,194 probably benign Het
Fcho1 A T 8: 71,708,953 S858T probably damaging Het
Fgfr1 A G 8: 25,568,198 D430G possibly damaging Het
Fmnl3 T C 15: 99,321,132 T807A probably damaging Het
Gabra5 T C 7: 57,413,728 Y316C probably damaging Het
Gh A G 11: 106,301,520 L16P probably damaging Het
Glipr2 A T 4: 43,970,532 I87F probably damaging Het
Glrb T A 3: 80,855,914 I259F probably damaging Het
Gpr63 T C 4: 25,007,651 L125P probably damaging Het
Grb2 A G 11: 115,655,425 Y37H probably damaging Het
Haus2 G A 2: 120,618,968 probably benign Het
Hmgcr T C 13: 96,652,145 N749S probably damaging Het
Igf1r T C 7: 68,165,242 V297A probably damaging Het
Il12rb2 G T 6: 67,316,286 P69H probably damaging Het
Ints3 C A 3: 90,408,511 M315I probably benign Het
Izumo2 C T 7: 44,715,409 T116I probably benign Het
Kctd19 A C 8: 105,395,361 Y185D probably damaging Het
Lama4 A G 10: 39,060,222 N631S possibly damaging Het
Lama5 T G 2: 180,178,079 probably null Het
Lamc1 A C 1: 153,262,439 L223R probably damaging Het
Lgr4 G A 2: 109,997,665 probably null Het
Loxhd1 T C 18: 77,339,500 L398P probably damaging Het
Mapk9 T A 11: 49,867,039 D103E possibly damaging Het
March6 T C 15: 31,469,532 probably benign Het
Mlxipl G A 5: 135,133,189 probably benign Het
Mrgbp C A 2: 180,583,438 D62E probably benign Het
Mtap A T 4: 89,151,998 probably benign Het
Myt1 G A 2: 181,801,871 G497S probably damaging Het
Naa25 T G 5: 121,407,184 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkpd1 T C 7: 19,519,927 C73R probably benign Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Nvl C A 1: 181,114,133 D581Y probably damaging Het
Olfr1102 T A 2: 87,002,366 Y132* probably null Het
Olfr1500 T C 19: 13,827,686 T237A probably damaging Het
Olfr568 T C 7: 102,877,861 V247A probably benign Het
Olfr575 T C 7: 102,954,978 M208V probably benign Het
Olfr905 A G 9: 38,473,316 T190A probably benign Het
Pcdh7 G T 5: 57,913,248 E1089D probably benign Het
Pik3cd A G 4: 149,656,379 probably null Het
Plekhh2 A T 17: 84,557,392 K69N probably damaging Het
Ptgdr2 G A 19: 10,940,428 C103Y probably damaging Het
Rrad A C 8: 104,628,667 H236Q probably benign Het
Rslcan18 C T 13: 67,098,469 A236T probably benign Het
Ryr2 C A 13: 11,824,379 D503Y probably damaging Het
Siglec1 T C 2: 131,075,060 T1092A probably benign Het
Siglecf A G 7: 43,355,926 T437A probably benign Het
Spta1 A T 1: 174,205,273 Q965H probably damaging Het
Stk10 A T 11: 32,589,460 E280V probably benign Het
Tfg T C 16: 56,690,988 Y326C possibly damaging Het
Trim25 G T 11: 89,015,772 V437L probably benign Het
Ttn T C 2: 76,743,683 D25622G probably damaging Het
Ube3b T A 5: 114,398,851 S303R probably benign Het
Ush2a T A 1: 188,578,491 V2088D probably damaging Het
Vmn2r103 A G 17: 19,811,979 T672A probably damaging Het
Wdr11 G T 7: 129,599,061 G79C probably damaging Het
Wdr89 T A 12: 75,632,593 T296S probably benign Het
Zdhhc24 T A 19: 4,880,374 L179M possibly damaging Het
Zfp981 T C 4: 146,537,760 C381R probably damaging Het
Zim1 A G 7: 6,676,948 I572T probably benign Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTTACACAGCTTGGAGTCAATG -3'
(R):5'- CTATGCACACTGCTTTTGGGCAC -3'

Sequencing Primer
(F):5'- ACAGCTTGGAGTCAATGTGATTTG -3'
(R):5'- cacaatgtaaagtgactgaaaatacc -3'
Posted On2013-05-09