Incidental Mutation 'R4280:Olfr1130'
ID322829
Institutional Source Beutler Lab
Gene Symbol Olfr1130
Ensembl Gene ENSMUSG00000059205
Gene Nameolfactory receptor 1130
SynonymsMOR264-4, GA_x6K02T2Q125-49112575-49113519
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87606212-87609852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87608251 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 288 (T288A)
Ref Sequence ENSEMBL: ENSMUSP00000078649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000213103] [ENSMUST00000216580]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079711
AA Change: T288A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: T288A

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213103
AA Change: T288A

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216580
AA Change: T288A

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 A T 6: 115,956,095 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Olfr1130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Olfr1130 APN 2 87607979 missense probably damaging 1.00
IGL01310:Olfr1130 APN 2 87607508 missense possibly damaging 0.68
IGL02558:Olfr1130 APN 2 87607559 missense probably benign 0.00
R0323:Olfr1130 UTSW 2 87607497 missense probably benign
R0590:Olfr1130 UTSW 2 87607994 missense probably damaging 0.98
R0718:Olfr1130 UTSW 2 87607927 missense probably benign 0.08
R2445:Olfr1130 UTSW 2 87607958 missense probably damaging 0.99
R3408:Olfr1130 UTSW 2 87607876 missense probably benign 0.03
R4491:Olfr1130 UTSW 2 87607392 start codon destroyed probably null 0.84
R4928:Olfr1130 UTSW 2 87608143 missense probably benign 0.06
R5033:Olfr1130 UTSW 2 87607711 missense probably damaging 1.00
R5061:Olfr1130 UTSW 2 87607832 missense probably benign 0.00
R5109:Olfr1130 UTSW 2 87607411 missense possibly damaging 0.64
R5109:Olfr1130 UTSW 2 87607975 missense possibly damaging 0.78
R5772:Olfr1130 UTSW 2 87608173 missense probably benign 0.12
R6004:Olfr1130 UTSW 2 87607909 missense probably damaging 1.00
R6005:Olfr1130 UTSW 2 87608080 missense probably damaging 0.97
R6411:Olfr1130 UTSW 2 87607973 missense probably damaging 1.00
R6964:Olfr1130 UTSW 2 87607613 missense probably damaging 1.00
R7085:Olfr1130 UTSW 2 87607406 missense probably benign 0.00
X0060:Olfr1130 UTSW 2 87608042 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCACCATTCTGAAGTTGCCAAC -3'
(R):5'- TTTCAGGCTATTACTCAAAGCAGC -3'

Sequencing Primer
(F):5'- TTCTGAAGTTGCCAACAGCCAC -3'
(R):5'- GGCTATTACTCAAAGCAGCACAGG -3'
Posted On2015-06-20