Incidental Mutation 'R4280:Fabp3'
ID322833
Institutional Source Beutler Lab
Gene Symbol Fabp3
Ensembl Gene ENSMUSG00000028773
Gene Namefatty acid binding protein 3, muscle and heart
SynonymsFabph4, Mdgi, H-FABP, Fabp3, Fabph1, Fabph-4, Fabph-1
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130308595-130315463 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 130312452 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070532] [ENSMUST00000097865] [ENSMUST00000134159]
Predicted Effect probably damaging
Transcript: ENSMUST00000070532
AA Change: R79W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070709
Gene: ENSMUSG00000028773
AA Change: R79W

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 3.2e-13 PFAM
Pfam:Lipocalin 6 132 4.5e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097865
SMART Domains Protein: ENSMUSP00000095477
Gene: ENSMUSG00000073752

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Meta Mutation Damage Score 0.6136 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Inactivation of this locus results in impaired fatty acid utilization. Homozygous null mice show exercise intolerance and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Fabp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
cardio UTSW 4 130312387 missense probably benign 0.21
R1111:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1112:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1114:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1116:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1144:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1460:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1505:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1506:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1508:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1509:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1582:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1601:Fabp3 UTSW 4 130308848 missense probably benign 0.24
R1612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1641:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1664:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1670:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1686:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1690:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1709:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1854:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1855:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1935:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2107:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2208:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2211:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2392:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2393:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2829:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2830:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2831:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2901:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2964:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2975:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2979:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2980:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2981:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2982:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2983:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3430:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3613:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3614:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3755:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3756:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3825:Fabp3 UTSW 4 130312452 unclassified probably null
R3842:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4012:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4282:Fabp3 UTSW 4 130312452 unclassified probably null
R4405:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4406:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4466:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4503:Fabp3 UTSW 4 130312452 unclassified probably null
R4547:Fabp3 UTSW 4 130312452 unclassified probably null
R4548:Fabp3 UTSW 4 130312452 unclassified probably null
R4671:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4681:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4710:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4743:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4850:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4989:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5015:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5133:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5134:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5549:Fabp3 UTSW 4 130315225 makesense probably null
R5884:Fabp3 UTSW 4 130312338 missense probably benign 0.01
R7170:Fabp3 UTSW 4 130313970 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATGTGTCCTCAACTATCTGCC -3'
(R):5'- GTGACAGCTGATAGATCCTTCCC -3'

Sequencing Primer
(F):5'- CCCTGCCCTTAGGTGTGG -3'
(R):5'- CTTCCCAGGAAGGTGAGAAG -3'
Posted On2015-06-20