Incidental Mutation 'R4280:Gm13078'
ID322834
Institutional Source Beutler Lab
Gene Symbol Gm13078
Ensembl Gene ENSMUSG00000046435
Gene Namepredicted gene 13078
Synonyms
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143719455-143729158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143726022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000077761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078695
AA Change: T8A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077761
Gene: ENSMUSG00000046435
AA Change: T8A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 4e-12 SMART
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Gm13078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Gm13078 APN 4 143727015 missense probably damaging 1.00
IGL01122:Gm13078 APN 4 143728401 missense probably benign 0.13
IGL02314:Gm13078 APN 4 143728442 missense probably benign 0.00
IGL03089:Gm13078 APN 4 143726133 missense probably benign 0.43
IGL03338:Gm13078 APN 4 143726742 missense probably benign 0.01
R0233:Gm13078 UTSW 4 143726063 missense possibly damaging 0.71
R0233:Gm13078 UTSW 4 143726063 missense possibly damaging 0.71
R0349:Gm13078 UTSW 4 143727059 missense probably benign 0.00
R0681:Gm13078 UTSW 4 143728052 missense probably benign
R0963:Gm13078 UTSW 4 143727108 missense possibly damaging 0.50
R1114:Gm13078 UTSW 4 143726855 missense probably benign 0.01
R2070:Gm13078 UTSW 4 143726902 nonsense probably null
R2475:Gm13078 UTSW 4 143726825 missense probably benign 0.14
R3824:Gm13078 UTSW 4 143726685 missense probably benign 0.00
R4050:Gm13078 UTSW 4 143727122 missense probably benign 0.01
R4125:Gm13078 UTSW 4 143726280 nonsense probably null
R4273:Gm13078 UTSW 4 143726846 nonsense probably null
R4921:Gm13078 UTSW 4 143728326 missense possibly damaging 0.95
R5223:Gm13078 UTSW 4 143728021 missense probably benign 0.00
R7256:Gm13078 UTSW 4 143726279 missense probably benign 0.23
Z1088:Gm13078 UTSW 4 143727033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTACCAGAAGGACCTTGAAGGATC -3'
(R):5'- GTTGGGAAAGGCCATGCTAC -3'

Sequencing Primer
(F):5'- ACCTTGAAGGATCTTTGGCAATGAG -3'
(R):5'- ACCACCATCTGCCTTAGTATGTTAGG -3'
Posted On2015-06-20