Incidental Mutation 'R4280:Zfp28'
ID322840
Institutional Source Beutler Lab
Gene Symbol Zfp28
Ensembl Gene ENSMUSG00000062861
Gene Namezinc finger protein 28
Synonymsmkr-5, 2810438M17Rik, Zfp-28
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6383295-6396915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6393701 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 378 (Q378H)
Ref Sequence ENSEMBL: ENSMUSP00000079812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081022]
Predicted Effect probably benign
Transcript: ENSMUST00000081022
AA Change: Q378H

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079812
Gene: ENSMUSG00000062861
AA Change: Q378H

DomainStartEndE-ValueType
low complexity region 27 50 N/A INTRINSIC
KRAB 103 163 3.53e-33 SMART
ZnF_C2H2 377 399 3.95e-4 SMART
ZnF_C2H2 405 427 6.88e-4 SMART
ZnF_C2H2 433 456 1.2e-3 SMART
ZnF_C2H2 462 484 9.58e-3 SMART
ZnF_C2H2 490 512 2.57e-3 SMART
ZnF_C2H2 518 540 1.82e-3 SMART
ZnF_C2H2 546 568 2.4e-3 SMART
ZnF_C2H2 574 596 6.32e-3 SMART
ZnF_C2H2 602 624 1.38e-3 SMART
ZnF_C2H2 630 652 4.87e-4 SMART
ZnF_C2H2 658 680 2.91e-2 SMART
ZnF_C2H2 686 708 2.36e-2 SMART
ZnF_C2H2 714 736 6.42e-4 SMART
ZnF_C2H2 742 764 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207086
Predicted Effect probably benign
Transcript: ENSMUST00000207465
Predicted Effect probably benign
Transcript: ENSMUST00000207809
Predicted Effect probably benign
Transcript: ENSMUST00000208338
Predicted Effect probably benign
Transcript: ENSMUST00000208949
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Zfp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Zfp28 APN 7 6393430 makesense probably null
IGL02300:Zfp28 APN 7 6389496 missense probably benign 0.00
IGL02541:Zfp28 APN 7 6393480 nonsense probably null
FR4340:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
FR4342:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
R0442:Zfp28 UTSW 7 6394999 missense probably damaging 1.00
R0462:Zfp28 UTSW 7 6392240 missense possibly damaging 0.71
R0799:Zfp28 UTSW 7 6384183 missense possibly damaging 0.49
R1081:Zfp28 UTSW 7 6389780 missense possibly damaging 0.93
R1674:Zfp28 UTSW 7 6394943 missense possibly damaging 0.90
R1783:Zfp28 UTSW 7 6394792 missense probably damaging 1.00
R2119:Zfp28 UTSW 7 6394876 missense probably benign 0.00
R2186:Zfp28 UTSW 7 6394498 missense probably damaging 1.00
R4281:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4283:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4331:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4379:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4380:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4505:Zfp28 UTSW 7 6394161 missense probably damaging 1.00
R4659:Zfp28 UTSW 7 6393507 missense probably benign 0.05
R4706:Zfp28 UTSW 7 6389794 missense probably damaging 0.99
R5524:Zfp28 UTSW 7 6394851 unclassified probably null
R6269:Zfp28 UTSW 7 6393613 missense probably benign 0.00
R6981:Zfp28 UTSW 7 6394693 missense probably damaging 1.00
R7117:Zfp28 UTSW 7 6394462 missense probably damaging 1.00
R7176:Zfp28 UTSW 7 6383457 missense possibly damaging 0.49
Y4340:Zfp28 UTSW 7 6394657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGCCTTCTCAGAGGG -3'
(R):5'- AGTACCTCCAGTGACGAACGAG -3'

Sequencing Primer
(F):5'- CCTTCTCAGAGGGGAGAGATG -3'
(R):5'- GTATGAAAGCTTTGCCACACTCCG -3'
Posted On2015-06-20