Incidental Mutation 'R4280:Dgat2'
ID322843
Institutional Source Beutler Lab
Gene Symbol Dgat2
Ensembl Gene ENSMUSG00000030747
Gene Namediacylglycerol O-acyltransferase 2
Synonyms
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99153658-99182719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99158997 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 157 (I157T)
Ref Sequence ENSEMBL: ENSMUSP00000033001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033001] [ENSMUST00000207491] [ENSMUST00000208591]
Predicted Effect probably damaging
Transcript: ENSMUST00000033001
AA Change: I157T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033001
Gene: ENSMUSG00000030747
AA Change: I157T

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Pfam:DAGAT 92 388 5.3e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207894
Predicted Effect probably benign
Transcript: ENSMUST00000208591
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutant mice die shortly after birth due to inadequate substrates for energy and impaired skin barrier function leading to dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Dgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Dgat2 UTSW 7 99157135 missense probably damaging 1.00
R0532:Dgat2 UTSW 7 99169781 missense possibly damaging 0.46
R1726:Dgat2 UTSW 7 99182416 missense possibly damaging 0.83
R2386:Dgat2 UTSW 7 99157093 missense possibly damaging 0.79
R3429:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3430:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3881:Dgat2 UTSW 7 99169743 nonsense probably null
R4279:Dgat2 UTSW 7 99164705 missense probably damaging 1.00
R4719:Dgat2 UTSW 7 99158297 missense probably benign 0.01
R6019:Dgat2 UTSW 7 99154631 missense probably benign 0.13
R6152:Dgat2 UTSW 7 99164678 missense probably benign 0.20
R6868:Dgat2 UTSW 7 99158306 missense probably benign 0.00
R7143:Dgat2 UTSW 7 99157124 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCATCGGGGAGGCTCAAAC -3'
(R):5'- CTGAGGACAGGTTTTGGAAAGTCTC -3'

Sequencing Primer
(F):5'- GCTCAAACCTTGACAGTGGAGC -3'
(R):5'- ACAGGTTTTGGAAAGTCTCTGCTG -3'
Posted On2015-06-20