Incidental Mutation 'R4280:Zbtb24'
ID322852
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Namezinc finger and BTB domain containing 24
SynonymsZNF450
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41450383-41465574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41464920 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 649 (S649P)
Ref Sequence ENSEMBL: ENSMUSP00000148861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]
Predicted Effect probably benign
Transcript: ENSMUST00000080771
AA Change: S671P

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: S671P

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213797
AA Change: S649P

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215881
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41451889 missense possibly damaging 0.63
R0485:Zbtb24 UTSW 10 41464536 missense probably damaging 0.96
R0553:Zbtb24 UTSW 10 41451997 missense possibly damaging 0.78
R0662:Zbtb24 UTSW 10 41462279 missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41451436 missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41464527 missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41464993 missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41451127 missense probably benign 0.28
R2299:Zbtb24 UTSW 10 41464581 missense probably damaging 1.00
R2371:Zbtb24 UTSW 10 41451268 missense probably damaging 1.00
R4281:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41451957 missense possibly damaging 0.89
R4991:Zbtb24 UTSW 10 41456618 splice site probably null
R5262:Zbtb24 UTSW 10 41464560 nonsense probably null
R5371:Zbtb24 UTSW 10 41451541 missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41464582 missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41464788 missense probably benign
R5785:Zbtb24 UTSW 10 41451853 missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41455175 missense probably damaging 1.00
R7189:Zbtb24 UTSW 10 41464476 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACATTCAGAGCCTCAGTG -3'
(R):5'- AGCTACCAATCTTGAAGAGACAAAG -3'

Sequencing Primer
(F):5'- CACATTCAGAGCCTCAGTGTGATTG -3'
(R):5'- CCCCCTCATTTAAGTATGAGTTGG -3'
Posted On2015-06-20