Incidental Mutation 'R4280:Tmtc2'
ID322854
Institutional Source Beutler Lab
Gene Symbol Tmtc2
Ensembl Gene ENSMUSG00000036019
Gene Nametransmembrane and tetratricopeptide repeat containing 2
SynonymsD330034A10Rik, 8430438D04Rik
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location105187663-105574451 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105348433 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061506]
Predicted Effect probably null
Transcript: ENSMUST00000061506
SMART Domains Protein: ENSMUSP00000061919
Gene: ENSMUSG00000036019

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Pfam:DUF1736 247 321 7.3e-33 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 425 444 N/A INTRINSIC
TPR 493 526 1.6e-3 SMART
TPR 527 560 6.84e-3 SMART
TPR 561 594 2.52e-1 SMART
TPR 606 639 3.12e-6 SMART
TPR 643 676 3.99e1 SMART
TPR 677 710 7.12e-1 SMART
low complexity region 729 739 N/A INTRINSIC
TPR 745 778 1.51e1 SMART
TPR 779 812 1.43e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143691
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein localized to the endoplasmic reticulum (ER). The encoded protein contains many tetratricopeptide repeats, sequences known for being involved in protein-protein interactions. This protein binds both the calcium uptake pump SERCA2B and the carbohydrate-binding chaperone calnexin, and it appears to play a role in calcium homeostasis in the ER. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Tmtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tmtc2 APN 10 105321446 missense possibly damaging 0.82
IGL01284:Tmtc2 APN 10 105271511 missense possibly damaging 0.56
IGL01317:Tmtc2 APN 10 105413785 missense probably damaging 1.00
IGL01327:Tmtc2 APN 10 105348479 missense probably benign 0.15
IGL01637:Tmtc2 APN 10 105370085 missense probably benign 0.00
IGL02176:Tmtc2 APN 10 105348493 missense probably benign 0.00
IGL02354:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02361:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02514:Tmtc2 APN 10 105190099 missense possibly damaging 0.94
IGL02540:Tmtc2 APN 10 105413339 missense probably benign 0.45
IGL02625:Tmtc2 APN 10 105370546 missense probably damaging 1.00
IGL02938:Tmtc2 APN 10 105413296 missense probably damaging 1.00
IGL02939:Tmtc2 APN 10 105370550 missense probably damaging 1.00
IGL03388:Tmtc2 APN 10 105321483 splice site probably benign
PIT4402001:Tmtc2 UTSW 10 105413407 missense probably damaging 1.00
PIT4449001:Tmtc2 UTSW 10 105303604 missense probably damaging 1.00
R1424:Tmtc2 UTSW 10 105413368 missense probably benign 0.00
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1529:Tmtc2 UTSW 10 105303658 missense probably damaging 1.00
R1903:Tmtc2 UTSW 10 105190108 missense probably benign 0.00
R2225:Tmtc2 UTSW 10 105370357 missense probably benign 0.22
R4602:Tmtc2 UTSW 10 105413530 missense probably benign
R4603:Tmtc2 UTSW 10 105413530 missense probably benign
R4624:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4625:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4628:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4629:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R5192:Tmtc2 UTSW 10 105190177 missense probably damaging 1.00
R5769:Tmtc2 UTSW 10 105370046 missense probably benign 0.00
R5846:Tmtc2 UTSW 10 105271441 intron probably benign
R5892:Tmtc2 UTSW 10 105413505 missense probably benign 0.08
R5897:Tmtc2 UTSW 10 105413598 missense probably damaging 1.00
R6362:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R6391:Tmtc2 UTSW 10 105573690 missense probably benign 0.06
R6640:Tmtc2 UTSW 10 105573749 start codon destroyed probably benign 0.01
R6812:Tmtc2 UTSW 10 105413269 missense probably benign 0.01
R6975:Tmtc2 UTSW 10 105323002 missense probably benign 0.01
R7042:Tmtc2 UTSW 10 105370616 missense probably damaging 1.00
R7063:Tmtc2 UTSW 10 105348525 missense probably damaging 1.00
R7211:Tmtc2 UTSW 10 105573726 missense probably benign 0.31
R7288:Tmtc2 UTSW 10 105413608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCACCTACTGATCTGAGAG -3'
(R):5'- CCCATGATGTTGCCTGGTAG -3'

Sequencing Primer
(F):5'- CACCTACTGATCTGAGAGTCTAATTG -3'
(R):5'- TGCCTGGTAGATGGATATTATGTC -3'
Posted On2015-06-20