Incidental Mutation 'R4280:Tob1'
ID322856
Institutional Source Beutler Lab
Gene Symbol Tob1
Ensembl Gene ENSMUSG00000037573
Gene Nametransducer of ErbB-2.1
SynonymsTrob, Tob
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94211454-94215495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94214322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000036039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041589]
Predicted Effect probably benign
Transcript: ENSMUST00000041589
AA Change: V228A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036039
Gene: ENSMUSG00000037573
AA Change: V228A

DomainStartEndE-ValueType
btg1 1 106 2.41e-77 SMART
low complexity region 141 160 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
low complexity region 238 280 N/A INTRINSIC
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and exhibit increased bone mass due to increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Tob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Tob1 APN 11 94214055 missense probably damaging 1.00
IGL02028:Tob1 APN 11 94214226 missense probably benign 0.43
IGL02866:Tob1 APN 11 94214057 missense possibly damaging 0.87
FR4304:Tob1 UTSW 11 94214464 small insertion probably benign
FR4304:Tob1 UTSW 11 94214477 nonsense probably null
FR4340:Tob1 UTSW 11 94214454 small insertion probably benign
FR4340:Tob1 UTSW 11 94214460 small insertion probably benign
FR4340:Tob1 UTSW 11 94214477 small insertion probably benign
FR4342:Tob1 UTSW 11 94214472 small insertion probably benign
FR4449:Tob1 UTSW 11 94214468 small insertion probably benign
FR4449:Tob1 UTSW 11 94214475 small insertion probably benign
FR4548:Tob1 UTSW 11 94214455 small insertion probably benign
FR4548:Tob1 UTSW 11 94214469 small insertion probably benign
FR4589:Tob1 UTSW 11 94214451 small insertion probably benign
FR4589:Tob1 UTSW 11 94214477 frame shift probably null
FR4737:Tob1 UTSW 11 94214451 small insertion probably benign
FR4737:Tob1 UTSW 11 94214464 small insertion probably benign
FR4737:Tob1 UTSW 11 94214478 small insertion probably benign
FR4976:Tob1 UTSW 11 94214472 small insertion probably benign
R0142:Tob1 UTSW 11 94214597 missense probably damaging 1.00
R1777:Tob1 UTSW 11 94213754 missense probably damaging 1.00
R4213:Tob1 UTSW 11 94214192 missense probably damaging 1.00
R4537:Tob1 UTSW 11 94214452 small deletion probably benign
R4899:Tob1 UTSW 11 94214452 small deletion probably benign
R5074:Tob1 UTSW 11 94213741 missense possibly damaging 0.88
R5502:Tob1 UTSW 11 94214452 small deletion probably benign
R5828:Tob1 UTSW 11 94213757 missense probably damaging 1.00
R5828:Tob1 UTSW 11 94213759 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCATGCCCATAAGCGACC -3'
(R):5'- TCCTTGGCATTGGGAGAAAGAG -3'

Sequencing Primer
(F):5'- GCCACTCTGCTGCTGTCAG -3'
(R):5'- GCAGAGGTTTGCTGCTGC -3'
Posted On2015-06-20