Incidental Mutation 'R4280:Slc38a10'
ID322858
Institutional Source Beutler Lab
Gene Symbol Slc38a10
Ensembl Gene ENSMUSG00000061306
Gene Namesolute carrier family 38, member 10
Synonyms1810073N04Rik
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120103960-120151346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120137878 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 202 (G202D)
Ref Sequence ENSEMBL: ENSMUSP00000099307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045402] [ENSMUST00000053692] [ENSMUST00000076697] [ENSMUST00000103018] [ENSMUST00000179094]
Predicted Effect probably damaging
Transcript: ENSMUST00000045402
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048675
Gene: ENSMUSG00000061306
AA Change: G202D

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1.5e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 699 735 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 1011 1019 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053692
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057615
Gene: ENSMUSG00000061306
AA Change: G202D

DomainStartEndE-ValueType
Pfam:Aa_trans 4 381 8.6e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076697
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075989
Gene: ENSMUSG00000061306
AA Change: G202D

DomainStartEndE-ValueType
Pfam:Aa_trans 4 389 4.7e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103018
AA Change: G202D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099307
Gene: ENSMUSG00000061306
AA Change: G202D

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 8.5e-55 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154444
Predicted Effect probably damaging
Transcript: ENSMUST00000179094
AA Change: G202D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136719
Gene: ENSMUSG00000061306
AA Change: G202D

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Meta Mutation Damage Score 0.0364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit a fragile skeleton, reduced adiposity, lean body mass, body weight/length, long bone length and bone mineral density, increased creatinine levels, reduced amylase and serum albumin levels, increased energy efficiency and oxygen consumption, and altered liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Slc38a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Slc38a10 APN 11 120138988 missense probably damaging 1.00
IGL00236:Slc38a10 APN 11 120106602 missense probably damaging 0.96
IGL01420:Slc38a10 APN 11 120106460 missense probably damaging 0.99
IGL01704:Slc38a10 APN 11 120151087 utr 5 prime probably benign
IGL01747:Slc38a10 APN 11 120134774 splice site probably benign
IGL02295:Slc38a10 APN 11 120116858 splice site probably benign
IGL02300:Slc38a10 APN 11 120110290 missense probably benign 0.00
IGL02429:Slc38a10 APN 11 120134888 splice site probably benign
IGL03155:Slc38a10 APN 11 120105119 missense probably damaging 0.96
IGL03396:Slc38a10 APN 11 120128475 missense probably damaging 1.00
cascade UTSW 11 120147819 missense probably damaging 1.00
cherries UTSW 11 120151077 start codon destroyed probably null 1.00
Ore UTSW 11 120134853 missense probably damaging 1.00
rainier UTSW 11 120129312 nonsense probably null
slag UTSW 11 120132741 missense probably damaging 1.00
R0048:Slc38a10 UTSW 11 120110312 missense probably benign 0.11
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0069:Slc38a10 UTSW 11 120106502 missense probably damaging 1.00
R0101:Slc38a10 UTSW 11 120151077 start codon destroyed probably null 1.00
R0743:Slc38a10 UTSW 11 120140643 missense probably damaging 1.00
R1159:Slc38a10 UTSW 11 120105475 missense probably benign
R2101:Slc38a10 UTSW 11 120132741 missense probably damaging 1.00
R2367:Slc38a10 UTSW 11 120110261 missense probably benign 0.12
R4282:Slc38a10 UTSW 11 120129264 missense probably damaging 1.00
R5206:Slc38a10 UTSW 11 120105062 missense probably damaging 0.99
R5658:Slc38a10 UTSW 11 120105392 missense probably benign 0.11
R6114:Slc38a10 UTSW 11 120129312 nonsense probably null
R6118:Slc38a10 UTSW 11 120132843 missense probably damaging 1.00
R6306:Slc38a10 UTSW 11 120147819 missense probably damaging 1.00
R6395:Slc38a10 UTSW 11 120124382 missense probably benign 0.01
R6428:Slc38a10 UTSW 11 120105472 missense probably benign 0.09
X0062:Slc38a10 UTSW 11 120116900 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCCTAGAGGAACAGTCTACACTAG -3'
(R):5'- CCAGGCTACAGGAATAAGCC -3'

Sequencing Primer
(F):5'- GGAACAGTCTACACTAGGTCAGC -3'
(R):5'- CTACAGGAATAAGCCAGCTTTG -3'
Posted On2015-06-20