Incidental Mutation 'R4280:Zfp429'
ID322861
Institutional Source Beutler Lab
Gene Symbol Zfp429
Ensembl Gene ENSMUSG00000078994
Gene Namezinc finger protein 429
Synonyms2810487A22Rik
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67387905-67399819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67390795 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 177 (C177G)
Ref Sequence ENSEMBL: ENSMUSP00000105354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109732] [ENSMUST00000181071] [ENSMUST00000224684] [ENSMUST00000224825]
Predicted Effect probably damaging
Transcript: ENSMUST00000109732
AA Change: C177G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105354
Gene: ENSMUSG00000078994
AA Change: C177G

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
ZnF_C2H2 119 141 5.12e1 SMART
ZnF_C2H2 147 169 2.27e-4 SMART
ZnF_C2H2 175 197 1.28e-3 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 259 281 4.62e1 SMART
ZnF_C2H2 287 309 5.14e-3 SMART
ZnF_C2H2 315 337 6.78e-3 SMART
ZnF_C2H2 343 365 3.11e-2 SMART
ZnF_C2H2 371 393 1.25e-1 SMART
ZnF_C2H2 399 421 6.32e-3 SMART
ZnF_C2H2 427 449 1.47e-3 SMART
ZnF_C2H2 455 477 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181071
SMART Domains Protein: ENSMUSP00000137755
Gene: ENSMUSG00000078994

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224684
Predicted Effect probably benign
Transcript: ENSMUST00000224825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225810
Meta Mutation Damage Score 0.478 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Other mutations in Zfp429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Zfp429 APN 13 67391013 missense probably damaging 0.96
IGL01913:Zfp429 APN 13 67396674 missense probably damaging 1.00
IGL02343:Zfp429 APN 13 67390725 missense probably damaging 0.98
IGL02679:Zfp429 APN 13 67399736 intron probably benign
IGL03396:Zfp429 APN 13 67396040 splice site probably benign
FR4342:Zfp429 UTSW 13 67396650 missense probably benign 0.02
R0012:Zfp429 UTSW 13 67390677 missense probably benign 0.01
R1232:Zfp429 UTSW 13 67390632 missense possibly damaging 0.47
R1330:Zfp429 UTSW 13 67396143 splice site probably null
R1653:Zfp429 UTSW 13 67389924 missense possibly damaging 0.87
R1761:Zfp429 UTSW 13 67396076 missense probably benign 0.28
R1813:Zfp429 UTSW 13 67390386 missense possibly damaging 0.55
R2356:Zfp429 UTSW 13 67390627 missense probably benign
R4283:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4464:Zfp429 UTSW 13 67390498 missense probably benign 0.13
R4789:Zfp429 UTSW 13 67390404 missense probably benign 0.06
R5187:Zfp429 UTSW 13 67390840 missense probably damaging 0.99
R5250:Zfp429 UTSW 13 67390519 missense probably benign 0.00
R6688:Zfp429 UTSW 13 67396130 missense probably damaging 0.98
R6772:Zfp429 UTSW 13 67390198 missense probably damaging 1.00
R6989:Zfp429 UTSW 13 67389961 missense probably benign 0.00
R7041:Zfp429 UTSW 13 67390711 missense probably damaging 1.00
R7101:Zfp429 UTSW 13 67390812 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCCTGAAGCGGTAGAGGAG -3'
(R):5'- GCAAACTGACTAATTGTAAATCGCTCC -3'

Sequencing Primer
(F):5'- GAGGGGGAAATCTTTTGACACATTC -3'
(R):5'- GAAACCCTACAAGTGTGGAGAATTTG -3'
Posted On2015-06-20