Incidental Mutation 'R4280:Pbrm1'
List |< first << previous [record 24 of 47] next >> last >|
ID322862
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Namepolybromo 1
SynonymsBAF180, Pb1, 2610016F04Rik, 2310032M22Rik
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31019138-31121592 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31107312 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000064032] [ENSMUST00000090214] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000123678] [ENSMUST00000136237] [ENSMUST00000156628] [ENSMUST00000203261]
Predicted Effect probably null
Transcript: ENSMUST00000022471
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022471
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022474
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022474
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000052239
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064032
SMART Domains Protein: ENSMUSP00000067418
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090214
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090214
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112092
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112092
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112098
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123678
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136237
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156628
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203261
SMART Domains Protein: ENSMUSP00000145018
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 31030927 missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 31052283 missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 31032404 splice site probably benign
IGL00674:Pbrm1 APN 14 31118776 missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 31052248 missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 31087619 missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 31052260 missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 31082604 missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 31089616 missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 31032510 missense probably benign 0.00
IGL02675:Pbrm1 APN 14 31106287 missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 31061513 missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 31067804 missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 31061551 missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 31110549 missense probably benign 0.00
IGL03290:Pbrm1 APN 14 31107284 missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 31085019 missense probably benign 0.04
IGL03386:Pbrm1 APN 14 31050092 missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 31067861 missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R0552:Pbrm1 UTSW 14 31035959 missense probably damaging 1.00
R0558:Pbrm1 UTSW 14 31085059 unclassified probably null
R0561:Pbrm1 UTSW 14 31035991 missense probably benign
R0591:Pbrm1 UTSW 14 31046430 splice site probably benign
R0835:Pbrm1 UTSW 14 31067579 missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 31050142 missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 31118852 missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 31074814 missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 31067502 missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 31032548 missense probably benign 0.07
R1843:Pbrm1 UTSW 14 31038957 missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 31106175 missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 31074893 missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 31032475 missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 31036003 missense probably benign 0.00
R4379:Pbrm1 UTSW 14 31067706 missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 31025556 missense probably benign 0.02
R4816:Pbrm1 UTSW 14 31110448 missense probably benign 0.32
R4939:Pbrm1 UTSW 14 31061623 missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 31052216 missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 31074827 missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 31032530 missense probably benign 0.00
R5276:Pbrm1 UTSW 14 31106184 missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 31082610 missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 31085011 missense probably damaging 0.96
R5476:Pbrm1 UTSW 14 31032519 missense probably benign 0.00
R5522:Pbrm1 UTSW 14 31089563 missense probably damaging 1.00
R5548:Pbrm1 UTSW 14 31105424 missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 31035992 missense probably benign 0.20
R6089:Pbrm1 UTSW 14 31087585 missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 31052283 missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 31050111 missense probably benign 0.19
R6335:Pbrm1 UTSW 14 31084095 missense probably damaging 1.00
R6499:Pbrm1 UTSW 14 31061509 missense probably damaging 0.99
R6823:Pbrm1 UTSW 14 31084790 missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R7021:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R7216:Pbrm1 UTSW 14 31045422 missense possibly damaging 0.93
Z1088:Pbrm1 UTSW 14 31110454 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTTACAGTCTACCCCAAAGTCTG -3'
(R):5'- CACAAGGATATGAGGCCAAGTC -3'

Sequencing Primer
(F):5'- GTCTACCCCAAAGTCTGCCAAAG -3'
(R):5'- GTCAGAGGCAACACTCCAGG -3'
Posted On2015-06-20