Mutagenetix > Incidental Mutation

Incidental Mutation 'R4280:Rec8'

322864

Institutional Source

Beutler Lab

Gene Symbol

Rec8

Ensembl Gene

ENSMUSG00000002324

Gene Name

REC8 meiotic recombination protein

Synonyms

Rec8L1, mrec

MMRRC Submission

041648-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4280 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55855494-55862852 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55856091 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 11 (H11R)

Ref Sequence

ENSEMBL: ENSMUSP00000002395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002395]

AlphaFold

Q8C5S7

Predicted Effect

probably damaging
Transcript: ENSMUST00000002395
AA Change: H11R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324
AA Change: H11R

Domain	Start	End	E-Value	Type
Pfam:Rad21_Rec8_N	1	117	2.2e-26	PFAM
low complexity region	235	249	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
coiled coil region	423	458	N/A	INTRINSIC
low complexity region	497	521	N/A	INTRINSIC
Pfam:Rad21_Rec8	536	590	9.2e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140335

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141425

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227922

Meta Mutation Damage Score

0.0951

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are infertile and exhibit small ovaries and testes. Females show absence of ovarian follicles and abnormal meiosis, while males exhibit abnormal chromosome pairing during meiosis, abnormal synaptonemal complex formation, and arrest of male meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap32	T	C	9: 32,171,185 (GRCm39)	C1322R	probably damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 117,721,122 (GRCm39)		probably benign	Het
Arvcf	G	A	16: 18,216,741 (GRCm39)	R292H	probably damaging	Het
Ccdc102a	C	A	8: 95,634,444 (GRCm39)	G382*	probably null	Het
Cd274	A	T	19: 29,357,871 (GRCm39)	M188L	probably benign	Het
Cep76	T	A	18: 67,773,229 (GRCm39)	D23V	probably benign	Het
Cimip3	T	C	17: 47,724,780 (GRCm39)	M17V	probably benign	Het
Clec12a	A	G	6: 129,340,892 (GRCm39)	Y224C	probably damaging	Het
Cplx2	A	G	13: 54,527,377 (GRCm39)	E87G	probably damaging	Het
Ctr9	A	G	7: 110,645,930 (GRCm39)		probably benign	Het
Dgat2	A	G	7: 98,808,204 (GRCm39)	I157T	probably damaging	Het
Epha1	G	T	6: 42,341,986 (GRCm39)	P355T	probably damaging	Het
Fabp3	C	T	4: 130,206,245 (GRCm39)		probably null	Het
Gmip	T	A	8: 70,266,251 (GRCm39)		probably benign	Het
Hephl1	A	G	9: 15,023,330 (GRCm39)	V24A	probably benign	Het
Itgb4	T	A	11: 115,881,761 (GRCm39)	M771K	probably damaging	Het
Mov10	A	C	3: 104,707,095 (GRCm39)	F635V	probably damaging	Het
Mtres1	A	T	10: 43,408,905 (GRCm39)	F79L	probably benign	Het
Or10ag60	A	G	2: 87,438,595 (GRCm39)	T288A	possibly damaging	Het
Or5an9	A	G	19: 12,187,302 (GRCm39)	Y124C	probably damaging	Het
Pbrm1	T	C	14: 30,829,269 (GRCm39)		probably null	Het
Plscr1l1	T	C	9: 92,225,701 (GRCm39)	Y8H	possibly damaging	Het
Plxnd1	A	T	6: 115,933,056 (GRCm39)		probably null	Het
Plxnd1	C	A	6: 115,933,055 (GRCm39)		probably benign	Het
Pnma5	T	C	X: 72,079,036 (GRCm39)	M549V	probably benign	Het
Polq	C	A	16: 36,902,419 (GRCm39)	Q2205K	probably damaging	Het
Ppp4r3c1	A	T	X: 88,976,105 (GRCm39)	W31R	probably damaging	Het
Pramel24	A	G	4: 143,452,592 (GRCm39)	T8A	possibly damaging	Het
Psma8	T	A	18: 14,854,292 (GRCm39)	D57E	probably benign	Het
Rbm47	T	C	5: 66,183,520 (GRCm39)	Y361C	probably damaging	Het
Ric1	A	G	19: 29,563,950 (GRCm39)	Y568C	probably damaging	Het
Rrp36	G	A	17: 46,983,302 (GRCm39)	T104I	probably damaging	Het
Rrs1	G	A	1: 9,616,364 (GRCm39)	G206S	probably damaging	Het
Scgb2b6	A	G	7: 31,318,367 (GRCm39)		noncoding transcript	Het
Skint5	T	A	4: 113,799,749 (GRCm39)	K126I	probably damaging	Het
Slc38a10	C	T	11: 120,028,704 (GRCm39)	G202D	probably damaging	Het
Supt5	G	A	7: 28,016,498 (GRCm39)	R761W	probably damaging	Het
Tmtc2	A	G	10: 105,184,294 (GRCm39)		probably null	Het
Tob1	T	C	11: 94,105,148 (GRCm39)	V228A	probably benign	Het
Traj44	T	C	14: 54,411,148 (GRCm39)		probably benign	Het
Trps1	G	A	15: 50,709,478 (GRCm39)	L291F	probably benign	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Ush2a	A	G	1: 188,310,658 (GRCm39)	Q2078R	probably benign	Het
Zbtb24	T	C	10: 41,340,916 (GRCm39)	S649P	probably benign	Het
Zfp28	A	T	7: 6,396,700 (GRCm39)	Q378H	probably benign	Het
Zfp429	A	C	13: 67,538,914 (GRCm39)	C177G	probably damaging	Het

Other mutations in Rec8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Rec8	APN	14	55,860,972 (GRCm39)	nonsense	probably null
IGL00427:Rec8	APN	14	55,856,108 (GRCm39)	missense	probably damaging	1.00
IGL02116:Rec8	APN	14	55,862,336 (GRCm39)	splice site	probably null
R1349:Rec8	UTSW	14	55,856,431 (GRCm39)	missense	probably damaging	1.00
R1372:Rec8	UTSW	14	55,856,431 (GRCm39)	missense	probably damaging	1.00
R1564:Rec8	UTSW	14	55,859,732 (GRCm39)	splice site	probably null
R1667:Rec8	UTSW	14	55,856,253 (GRCm39)	missense	probably damaging	1.00
R1970:Rec8	UTSW	14	55,861,599 (GRCm39)	missense	probably damaging	1.00
R3157:Rec8	UTSW	14	55,862,763 (GRCm39)	missense	probably damaging	0.96
R3625:Rec8	UTSW	14	55,859,954 (GRCm39)	missense	possibly damaging	0.94
R3919:Rec8	UTSW	14	55,858,716 (GRCm39)	missense	probably benign	0.02
R4282:Rec8	UTSW	14	55,856,091 (GRCm39)	missense	probably damaging	1.00
R4283:Rec8	UTSW	14	55,856,091 (GRCm39)	missense	probably damaging	1.00
R4622:Rec8	UTSW	14	55,862,215 (GRCm39)	missense	probably damaging	1.00
R4894:Rec8	UTSW	14	55,862,787 (GRCm39)	missense	probably damaging	1.00
R5488:Rec8	UTSW	14	55,860,283 (GRCm39)	missense	probably benign	0.00
R5489:Rec8	UTSW	14	55,860,283 (GRCm39)	missense	probably benign	0.00
R6113:Rec8	UTSW	14	55,859,935 (GRCm39)	missense	probably damaging	0.99
R6264:Rec8	UTSW	14	55,856,636 (GRCm39)	missense	probably damaging	1.00
R6439:Rec8	UTSW	14	55,856,076 (GRCm39)	missense	possibly damaging	0.50
R7952:Rec8	UTSW	14	55,862,760 (GRCm39)	missense	possibly damaging	0.93
Z1088:Rec8	UTSW	14	55,862,604 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAGGAGGGATGCTTAGCTCC -3'
(R):5'- TTCCTCGCTGGGAGAACAAG -3'

Sequencing Primer
(F):5'- CCTAATTCAGTTGTATAGTCAGTCG -3'
(R):5'- CTGGGAGAACAAGAAGCCCTGATC -3'

Posted On

2015-06-20