Incidental Mutation 'R4280:Rrp36'
ID322868
Institutional Source Beutler Lab
Gene Symbol Rrp36
Ensembl Gene ENSMUSG00000023971
Gene Nameribosomal RNA processing 36 homolog (S. cerevisiae)
SynonymsBC011248
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46667458-46674255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46672376 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 104 (T104I)
Ref Sequence ENSEMBL: ENSMUSP00000024766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024766] [ENSMUST00000071841] [ENSMUST00000165007]
Predicted Effect probably damaging
Transcript: ENSMUST00000024766
AA Change: T104I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971
AA Change: T104I

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071841
SMART Domains Protein: ENSMUSP00000071743
Gene: ENSMUSG00000063576

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 1.6e-8 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_4 13 65 3.8e-8 PFAM
Pfam:Kelch_6 13 67 9.6e-11 PFAM
Pfam:Kelch_5 73 113 3.1e-8 PFAM
Pfam:Kelch_1 76 117 1.9e-7 PFAM
Pfam:Kelch_6 76 121 1.7e-9 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_4 77 125 4.6e-11 PFAM
Pfam:Kelch_3 86 136 1.3e-12 PFAM
Pfam:Kelch_1 127 172 1.5e-10 PFAM
Pfam:Kelch_6 127 173 2e-10 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.3e-10 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_1 180 233 5.8e-9 PFAM
Pfam:Kelch_3 189 247 7.3e-8 PFAM
Pfam:Kelch_5 235 276 1.2e-11 PFAM
Pfam:Kelch_1 238 284 2.7e-8 PFAM
Pfam:Kelch_6 238 293 2.4e-12 PFAM
Pfam:Kelch_3 248 299 4.2e-10 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165007
SMART Domains Protein: ENSMUSP00000128271
Gene: ENSMUSG00000063576

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 9.9e-10 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_6 13 66 7.5e-11 PFAM
Pfam:Kelch_4 13 71 1.4e-8 PFAM
Pfam:Kelch_5 73 113 3e-8 PFAM
Pfam:Kelch_1 76 118 2.6e-8 PFAM
Pfam:Kelch_6 76 121 1.1e-10 PFAM
Pfam:Kelch_4 76 126 2e-11 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_3 86 136 7.7e-12 PFAM
Pfam:Kelch_1 127 170 1.2e-8 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.7e-7 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_6 179 239 2.5e-9 PFAM
Pfam:Kelch_1 180 232 3.4e-8 PFAM
Pfam:Kelch_3 189 247 5.7e-8 PFAM
Pfam:Kelch_5 235 276 4.3e-10 PFAM
Pfam:Kelch_1 238 285 9.3e-10 PFAM
Pfam:Kelch_4 238 291 9.9e-8 PFAM
Pfam:Kelch_6 238 293 2.5e-12 PFAM
Pfam:Kelch_3 248 299 1.1e-9 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RRP36 functions at an early stage in the processing of 35S preribosomal RNA into the mature 18S species (Gerus et al., 2010 [PubMed 20038530]).[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Rrp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Rrp36 APN 17 46668091 unclassified probably benign
R1085:Rrp36 UTSW 17 46667952 makesense probably null
R1328:Rrp36 UTSW 17 46672779 nonsense probably null
R1470:Rrp36 UTSW 17 46672380 nonsense probably null
R1470:Rrp36 UTSW 17 46672380 nonsense probably null
R1672:Rrp36 UTSW 17 46672414 missense probably damaging 0.99
R1920:Rrp36 UTSW 17 46672745 missense possibly damaging 0.78
R1922:Rrp36 UTSW 17 46672745 missense possibly damaging 0.78
R2215:Rrp36 UTSW 17 46672820 missense possibly damaging 0.92
R3930:Rrp36 UTSW 17 46672806 missense probably damaging 0.98
R4747:Rrp36 UTSW 17 46669967 missense possibly damaging 0.87
R5809:Rrp36 UTSW 17 46668006 missense probably damaging 1.00
R6875:Rrp36 UTSW 17 46672371 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCCACAGGCGTTAGTAATGAC -3'
(R):5'- TTCTTACGTCAGGTGGTGCC -3'

Sequencing Primer
(F):5'- CACAGGCGTTAGTAATGACTACTATC -3'
(R):5'- TGGTGCCCATCAGTAAAAAGGTG -3'
Posted On2015-06-20