Incidental Mutation 'R4281:Iqgap3'
ID322885
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 041649-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R4281 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88098860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 526 (V526A)
Ref Sequence ENSEMBL: ENSMUSP00000071715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000195465]
Predicted Effect probably benign
Transcript: ENSMUST00000071812
AA Change: V526A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: V526A

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195465
AA Change: V526A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068
AA Change: V526A

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 92% (44/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
B9d2 A G 7: 25,681,426 T14A possibly damaging Het
Cavin3 A C 7: 105,481,774 probably null Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Evc2 T C 5: 37,338,594 V16A probably benign Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Gimap8 A C 6: 48,658,820 R506S probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Gtf2a1l A G 17: 88,711,637 N383S possibly damaging Het
Hepacam2 G A 6: 3,475,938 T329I probably damaging Het
Lrrc6 A T 15: 66,380,529 H429Q probably benign Het
Mark4 T C 7: 19,433,446 K456R probably benign Het
Nox4 A G 7: 87,297,524 I143V possibly damaging Het
Olfr530 A G 7: 140,373,472 I46T probably benign Het
Olfr746 T C 14: 50,653,572 C112R probably benign Het
Pcdh18 A G 3: 49,756,533 L111P possibly damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Pnpla6 T C 8: 3,521,513 L148P probably damaging Het
Prkdc A G 16: 15,806,099 probably null Het
Rars T C 11: 35,821,224 E275G probably damaging Het
Rasa3 A G 8: 13,588,946 V287A probably benign Het
Rimbp2 C T 5: 128,788,340 R641Q possibly damaging Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tmem132a C G 19: 10,861,726 E451Q possibly damaging Het
Tmem229b-ps A G 10: 53,475,378 noncoding transcript Het
Trim33 T A 3: 103,329,086 V504D probably damaging Het
Usp47 A T 7: 112,109,993 E1315D probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp612 A G 8: 110,090,059 I594V probably damaging Het
Zfp692 T C 11: 58,314,265 F447L probably damaging Het
Zranb3 A C 1: 127,963,877 S787R possibly damaging Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGACAGCTCCCCTCAG -3'
(R):5'- TGTCTAACCCAGCCATCTCT -3'

Sequencing Primer
(F):5'- TCAGACATCTCCCCCTCAG -3'
(R):5'- AGCCATCTCTCCCTAACCTTAC -3'
Posted On2015-06-20