Incidental Mutation 'R4281:Nox4'
ID322894
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
MMRRC Submission 041649-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R4281 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87297524 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 143 (I143V)
Ref Sequence ENSEMBL: ENSMUSP00000119365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000124057] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably benign
Transcript: ENSMUST00000032781
AA Change: I112V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: I112V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068829
AA Change: I112V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: I112V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124057
AA Change: I143V

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119365
Gene: ENSMUSG00000030562
AA Change: I143V

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127138
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik T C X: 51,968,990 Y273C probably damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
B9d2 A G 7: 25,681,426 T14A possibly damaging Het
Cavin3 A C 7: 105,481,774 probably null Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Evc2 T C 5: 37,338,594 V16A probably benign Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Gimap8 A C 6: 48,658,820 R506S probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Gtf2a1l A G 17: 88,711,637 N383S possibly damaging Het
Hepacam2 G A 6: 3,475,938 T329I probably damaging Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Lrrc6 A T 15: 66,380,529 H429Q probably benign Het
Mark4 T C 7: 19,433,446 K456R probably benign Het
Olfr530 A G 7: 140,373,472 I46T probably benign Het
Olfr746 T C 14: 50,653,572 C112R probably benign Het
Pcdh18 A G 3: 49,756,533 L111P possibly damaging Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Pnpla6 T C 8: 3,521,513 L148P probably damaging Het
Prkdc A G 16: 15,806,099 probably null Het
Rars T C 11: 35,821,224 E275G probably damaging Het
Rasa3 A G 8: 13,588,946 V287A probably benign Het
Rimbp2 C T 5: 128,788,340 R641Q possibly damaging Het
Slco6b1 A G 1: 96,997,390 noncoding transcript Het
Sned1 A T 1: 93,285,855 R426* probably null Het
Tmem132a C G 19: 10,861,726 E451Q possibly damaging Het
Tmem229b-ps A G 10: 53,475,378 noncoding transcript Het
Trim33 T A 3: 103,329,086 V504D probably damaging Het
Usp47 A T 7: 112,109,993 E1315D probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp612 A G 8: 110,090,059 I594V probably damaging Het
Zfp692 T C 11: 58,314,265 F447L probably damaging Het
Zranb3 A C 1: 127,963,877 S787R possibly damaging Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTATGCCACGGTTCTCTC -3'
(R):5'- TGTAACTGCCCTCACAACTC -3'

Sequencing Primer
(F):5'- GGTTCTCTCACTTTTGACTAGGAGAC -3'
(R):5'- TCTCTTCTAACTCTCACAAAAGAGG -3'
Posted On2015-06-20