Incidental Mutation 'R4290:Il19'
ID322978
Institutional Source Beutler Lab
Gene Symbol Il19
Ensembl Gene ENSMUSG00000016524
Gene Nameinterleukin 19
Synonyms
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130932656-130940115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130935013 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 58 (T58S)
Ref Sequence ENSEMBL: ENSMUSP00000141175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016668] [ENSMUST00000112465] [ENSMUST00000187410] [ENSMUST00000187916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016668
AA Change: T133S

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016668
Gene: ENSMUSG00000016524
AA Change: T133S

DomainStartEndE-ValueType
IL10 30 171 1.64e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112465
AA Change: T133S

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108084
Gene: ENSMUSG00000016524
AA Change: T133S

DomainStartEndE-ValueType
IL10 30 171 1.64e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187410
AA Change: T133S

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139406
Gene: ENSMUSG00000016524
AA Change: T133S

DomainStartEndE-ValueType
IL10 30 171 1.64e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187916
AA Change: T58S

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141175
Gene: ENSMUSG00000016524
AA Change: T58S

DomainStartEndE-ValueType
SCOP:d1lqsl_ 1 91 8e-26 SMART
PDB:1N1F|A 1 95 6e-45 PDB
Blast:IL10 1 96 5e-65 BLAST
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit interleukin-23 (IL-23)-dependent epidermal hyperplasia. Mice homozygous for a different knock-out allele exhibit increased susceptibility to induced colitis with reduced B cell infiltration in chronic colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Il19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Il19 APN 1 130935055 splice site probably benign
R1969:Il19 UTSW 1 130939156 missense probably damaging 1.00
R2064:Il19 UTSW 1 130939117 missense probably benign
R2851:Il19 UTSW 1 130935957 missense possibly damaging 0.73
R3977:Il19 UTSW 1 130936033 missense probably damaging 1.00
R4857:Il19 UTSW 1 130935946 missense probably damaging 1.00
R6016:Il19 UTSW 1 130935981 missense probably damaging 1.00
R6209:Il19 UTSW 1 130939115 missense possibly damaging 0.68
R7113:Il19 UTSW 1 130934995 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAACTTGGATGAGCTTGCCATG -3'
(R):5'- AGACACGGTACTCGCTCTTC -3'

Sequencing Primer
(F):5'- TGAGCTTGCCATGAAGACC -3'
(R):5'- GAGGTCAAATGCAGAGCTTCTCC -3'
Posted On2015-06-20