Incidental Mutation 'R4290:Cckar'
ID322994
Institutional Source Beutler Lab
Gene Symbol Cckar
Ensembl Gene ENSMUSG00000029193
Gene Namecholecystokinin A receptor
Synonyms
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4290 (G1)
Quality Score223
Status Validated
Chromosome5
Chromosomal Location53697776-53707705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53706497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000031093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031093] [ENSMUST00000200691]
Predicted Effect probably benign
Transcript: ENSMUST00000031093
AA Change: S41P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031093
Gene: ENSMUSG00000029193
AA Change: S41P

DomainStartEndE-ValueType
Pfam:CholecysA-Rec_N 1 47 8.8e-29 PFAM
Pfam:7tm_4 48 252 7.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 52 393 2.6e-10 PFAM
Pfam:7tm_1 58 378 1.1e-66 PFAM
low complexity region 399 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200691
SMART Domains Protein: ENSMUSP00000144103
Gene: ENSMUSG00000029193

DomainStartEndE-ValueType
Pfam:7tm_1 1 307 1.6e-59 PFAM
Pfam:7tm_4 3 181 1.8e-6 PFAM
low complexity region 328 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202946
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor that binds non-sulfated members of the cholecystokinin (CCK) family of peptide hormones. This receptor is a major physiologic mediator of pancreatic enzyme secretion and smooth muscle contraction of the gallbladder and stomach. In the central and peripheral nervous system this receptor regulates satiety and the release of beta-endorphin and dopamine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice cannot regulate core body temperature in response to changes in ambient temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Cckar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cckar APN 5 53699829 missense possibly damaging 0.86
IGL00568:Cckar APN 5 53707301 missense probably benign 0.02
IGL00766:Cckar APN 5 53700036 missense probably damaging 0.99
IGL00960:Cckar APN 5 53701292 missense probably damaging 1.00
IGL02424:Cckar APN 5 53706428 missense possibly damaging 0.63
IGL03002:Cckar APN 5 53702905 missense probably damaging 0.99
R0167:Cckar UTSW 5 53706453 missense probably damaging 1.00
R0302:Cckar UTSW 5 53700299 frame shift probably null
R0366:Cckar UTSW 5 53700165 missense probably benign 0.01
R0391:Cckar UTSW 5 53706253 critical splice donor site probably null
R0981:Cckar UTSW 5 53706290 missense probably damaging 1.00
R1619:Cckar UTSW 5 53700067 missense probably damaging 1.00
R1644:Cckar UTSW 5 53699873 missense probably benign
R1779:Cckar UTSW 5 53699979 missense probably damaging 1.00
R2184:Cckar UTSW 5 53702912 missense probably damaging 0.96
R4291:Cckar UTSW 5 53706497 missense probably benign
R4292:Cckar UTSW 5 53706497 missense probably benign
R4294:Cckar UTSW 5 53706497 missense probably benign
R4518:Cckar UTSW 5 53699922 missense probably damaging 1.00
R4583:Cckar UTSW 5 53699782 missense probably benign 0.01
R5139:Cckar UTSW 5 53702923 missense probably benign 0.00
R5505:Cckar UTSW 5 53703068 missense probably damaging 1.00
R6207:Cckar UTSW 5 53699844 missense probably benign
R6415:Cckar UTSW 5 53703056 missense probably damaging 1.00
R7127:Cckar UTSW 5 53706475 missense probably damaging 1.00
X0028:Cckar UTSW 5 53707273 missense probably benign 0.22
X0028:Cckar UTSW 5 53707274 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAGGTTGAACGGCATGC -3'
(R):5'- ACTGCTTTCCTGACGGATCC -3'

Sequencing Primer
(F):5'- GTTGAACGGCATGCAGAAG -3'
(R):5'- TCCTGACGGATCCCATTAACATC -3'
Posted On2015-06-20