Incidental Mutation 'R4290:Auts2'
ID322996
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131474971 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 225 (S225P)
Ref Sequence ENSEMBL: ENSMUSP00000139759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160071
SMART Domains Protein: ENSMUSP00000125349
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 194 406 2.3e-108 PFAM
low complexity region 433 446 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 763 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161226
SMART Domains Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

DomainStartEndE-ValueType
low complexity region 11 45 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
low complexity region 330 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161374
AA Change: S16P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: S16P

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161804
AA Change: S16P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: S16P

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183153
Predicted Effect probably damaging
Transcript: ENSMUST00000187544
AA Change: S225P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: S225P

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198149
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGCTGAACCCCAGTCAC -3'
(R):5'- TTTTATTCTGACAGCAGCAGC -3'

Sequencing Primer
(F):5'- TCACAAAAGACTTGAAAGAGACTCTG -3'
(R):5'- TTTATTCTGACAGCAGCAGCAGAAG -3'
Posted On2015-06-20