Incidental Mutation 'R4290:Kcna1'
ID322999
Institutional Source Beutler Lab
Gene Symbol Kcna1
Ensembl Gene ENSMUSG00000047976
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 1
Synonymsmouse brain potassium channel protein-1, MBK1, Shak, Kv1.1, Mk-1, mceph
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126640397-126646384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126641875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 494 (D494G)
Ref Sequence ENSEMBL: ENSMUSP00000144947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055168] [ENSMUST00000203094]
Predicted Effect probably damaging
Transcript: ENSMUST00000055168
AA Change: D494G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055225
Gene: ENSMUSG00000047976
AA Change: D494G

DomainStartEndE-ValueType
BTB 37 137 2.44e-10 SMART
Pfam:Ion_trans 166 419 1.4e-52 PFAM
Pfam:Ion_trans_2 327 412 1.3e-15 PFAM
low complexity region 437 452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203094
AA Change: D494G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144947
Gene: ENSMUSG00000047976
AA Change: D494G

DomainStartEndE-ValueType
BTB 37 137 2.44e-10 SMART
Pfam:Ion_trans 166 419 1.4e-52 PFAM
Pfam:Ion_trans_2 327 412 1.3e-15 PFAM
low complexity region 437 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205171
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated delayed potassium channel that is phylogenetically related to the Drosophila Shaker channel. The encoded protein has six putative transmembrane segments (S1-S6), and the loop between S5 and S6 forms the pore and contains the conserved selectivity filter motif (GYGD). The functional channel is a homotetramer. The N-terminus of the channel is associated with beta subunits that can modify the inactivation properties of the channel as well as affect expression levels. The C-terminus of the channel is complexed to a PDZ domain protein that is responsible for channel targeting. Mutations in this gene have been associated with myokymia with periodic ataxia (AEMK). [provided by RefSeq, Jul 2008]
PHENOTYPE: Various mutations at this allele have diverse affects including behavioral abnormalities, megencephaly, and in one case, embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Kcna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Kcna1 APN 6 126642906 missense probably damaging 1.00
IGL02361:Kcna1 APN 6 126642906 missense probably damaging 1.00
IGL02900:Kcna1 APN 6 126643094 missense probably damaging 1.00
IGL03046:Kcna1 UTSW 6 126642185 missense possibly damaging 0.84
R0694:Kcna1 UTSW 6 126642245 missense probably damaging 0.99
R1530:Kcna1 UTSW 6 126642531 missense probably benign
R1531:Kcna1 UTSW 6 126642067 missense probably benign 0.30
R1676:Kcna1 UTSW 6 126642682 missense probably damaging 1.00
R1750:Kcna1 UTSW 6 126642808 missense probably benign 0.06
R3815:Kcna1 UTSW 6 126643046 missense probably damaging 1.00
R4012:Kcna1 UTSW 6 126642910 missense probably benign
R4492:Kcna1 UTSW 6 126642275 missense possibly damaging 0.95
R4820:Kcna1 UTSW 6 126642136 missense probably damaging 1.00
R5114:Kcna1 UTSW 6 126642367 missense probably damaging 0.99
R5433:Kcna1 UTSW 6 126643112 missense probably damaging 1.00
R6171:Kcna1 UTSW 6 126642323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTTCAGGTTCGCCAC -3'
(R):5'- TTCTACCACCGAGAAACTGAGG -3'

Sequencing Primer
(F):5'- GGTTCGCCACTCCCCAAATTC -3'
(R):5'- TAACTTAGCCTCTGACAGTGAC -3'
Posted On2015-06-20