Incidental Mutation 'R4290:Xndc1'
ID323004
Institutional Source Beutler Lab
Gene Symbol Xndc1
Ensembl Gene ENSMUSG00000099481
Gene NameXrcc1 N-terminal domain containing 1
SynonymsXndr
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102065511-102083765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102081487 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 288 (L288M)
Ref Sequence ENSEMBL: ENSMUSP00000081903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084843] [ENSMUST00000094129] [ENSMUST00000094130] [ENSMUST00000106950] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104] [ENSMUST00000142629] [ENSMUST00000146450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084843
AA Change: L288M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425
AA Change: L288M

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094129
AA Change: L288M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091679
Gene: ENSMUSG00000070425
AA Change: L288M

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.2e-27 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 2.8e-28 PFAM
transmembrane domain 719 741 N/A INTRINSIC
Pfam:PKD_channel 772 1019 3.8e-12 PFAM
Pfam:Ion_trans 796 1012 3.9e-31 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094130
AA Change: L288M

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091680
Gene: ENSMUSG00000099481
AA Change: L288M

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000106950
AA Change: L288M

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102563
Gene: ENSMUSG00000099481
AA Change: L288M

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000123372
AA Change: L288M

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425
AA Change: L288M

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125197
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140395
Predicted Effect probably benign
Transcript: ENSMUST00000142629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143839
Predicted Effect probably benign
Transcript: ENSMUST00000146450
SMART Domains Protein: ENSMUSP00000117300
Gene: ENSMUSG00000099481

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153176
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype Homozygous null mice exhibit altered sexual and social behavior, including intermale mounting and a lack of aggressive behavior in the presence of invading males. Homozygotes for another allele show increased triglyceride levels in both males and females and increased cholesterol in males.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Xndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0415:Xndc1 UTSW 7 102080616 splice site probably benign
R0648:Xndc1 UTSW 7 102078824 missense possibly damaging 0.46
R1990:Xndc1 UTSW 7 102073191 missense probably damaging 1.00
R1991:Xndc1 UTSW 7 102073191 missense probably damaging 1.00
R4295:Xndc1 UTSW 7 102081487 missense possibly damaging 0.95
R4530:Xndc1 UTSW 7 102078735 missense probably benign 0.21
R4815:Xndc1 UTSW 7 102073316 missense probably null 1.00
R5384:Xndc1 UTSW 7 102082188 missense probably benign 0.12
R6838:Xndc1 UTSW 7 102073269 missense possibly damaging 0.79
R6940:Xndc1 UTSW 7 102077887 missense probably benign 0.15
R7310:Xndc1 UTSW 7 102078731 critical splice acceptor site probably null
X0060:Xndc1 UTSW 7 102079148 missense probably benign 0.08
X0065:Xndc1 UTSW 7 102081485 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTCTGTTGTCAAATGCTCG -3'
(R):5'- AGGCTTGGACAAATCAAAACTG -3'

Sequencing Primer
(F):5'- GAAGGTTAACTGCTTTCCTCCAAG -3'
(R):5'- GCTTCTCCAACTATTTGAGACAGGG -3'
Posted On2015-06-20