Incidental Mutation 'R4290:Mapkapk3'
ID323014
Institutional Source Beutler Lab
Gene Symbol Mapkapk3
Ensembl Gene ENSMUSG00000032577
Gene Namemitogen-activated protein kinase-activated protein kinase 3
SynonymsMK3
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107254927-107289877 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 107258932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035194] [ENSMUST00000134682] [ENSMUST00000192054]
Predicted Effect probably benign
Transcript: ENSMUST00000035194
SMART Domains Protein: ENSMUSP00000035194
Gene: ENSMUSG00000032577

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
S_TKc 45 306 4.97e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128175
Predicted Effect probably benign
Transcript: ENSMUST00000134682
SMART Domains Protein: ENSMUSP00000120848
Gene: ENSMUSG00000032577

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155860
Predicted Effect probably benign
Transcript: ENSMUST00000192054
SMART Domains Protein: ENSMUSP00000141342
Gene: ENSMUSG00000032577

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
Pfam:Pkinase 46 264 6.3e-48 PFAM
Pfam:Pkinase_Tyr 47 259 1.1e-27 PFAM
Pfam:Kdo 80 202 1.1e-8 PFAM
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal tissue morphology, behavior, and LPS-induced production of cytokines. Eyes of homozygous null mice show defects in Bruch's membrane, with disorganized architecture and variability in thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Mapkapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Mapkapk3 APN 9 107262422 critical splice donor site probably null
IGL02486:Mapkapk3 APN 9 107289268 missense probably damaging 1.00
IGL02971:Mapkapk3 APN 9 107257080 missense probably benign 0.00
R1523:Mapkapk3 UTSW 9 107263623 critical splice donor site probably null
R4106:Mapkapk3 UTSW 9 107257066 missense probably damaging 0.99
R4291:Mapkapk3 UTSW 9 107258932 intron probably benign
R4293:Mapkapk3 UTSW 9 107258932 intron probably benign
R4294:Mapkapk3 UTSW 9 107258932 intron probably benign
R4299:Mapkapk3 UTSW 9 107257449 missense probably damaging 1.00
R5433:Mapkapk3 UTSW 9 107256292 missense probably damaging 0.96
R5936:Mapkapk3 UTSW 9 107289170 missense probably damaging 0.96
R6029:Mapkapk3 UTSW 9 107289226 missense possibly damaging 0.86
R6228:Mapkapk3 UTSW 9 107260063 missense probably damaging 1.00
R6520:Mapkapk3 UTSW 9 107257449 missense probably damaging 1.00
R7011:Mapkapk3 UTSW 9 107289396 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGTTTCAAGGCCTGTATC -3'
(R):5'- GGGGTTTGTCTGAAAGCAGC -3'

Sequencing Primer
(F):5'- CAGTTTCAAGGCCTGTATCTAACAAC -3'
(R):5'- TCACACACATGCTGCCT -3'
Posted On2015-06-20