Incidental Mutation 'R4290:Bclaf1'
ID323016
Institutional Source Beutler Lab
Gene Symbol Bclaf1
Ensembl Gene ENSMUSG00000037608
Gene NameBCL2-associated transcription factor 1
Synonyms5730534O06Rik, 2810454G14Rik, 2700025J07Rik, 2610102K23Rik
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location20312469-20344613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20323778 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 20 (Q20R)
Ref Sequence ENSEMBL: ENSMUSP00000140702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043881] [ENSMUST00000092678] [ENSMUST00000185800] [ENSMUST00000186100] [ENSMUST00000189158] [ENSMUST00000190156] [ENSMUST00000191438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043881
AA Change: Q307R

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043583
Gene: ENSMUSG00000037608
AA Change: Q307R

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 766 1.6e-181 PFAM
low complexity region 793 824 N/A INTRINSIC
low complexity region 861 874 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092678
AA Change: Q307R

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090349
Gene: ENSMUSG00000037608
AA Change: Q307R

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 789 5.4e-191 PFAM
low complexity region 812 825 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185800
AA Change: Q305R

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140623
Gene: ENSMUSG00000037608
AA Change: Q305R

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 787 7.2e-191 PFAM
low complexity region 791 822 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186100
AA Change: Q307R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140101
Gene: ENSMUSG00000037608
AA Change: Q307R

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 742 6.4e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187338
Predicted Effect probably benign
Transcript: ENSMUST00000189158
Predicted Effect probably damaging
Transcript: ENSMUST00000190156
AA Change: Q305R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140428
Gene: ENSMUSG00000037608
AA Change: Q305R

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 740 4.2e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191438
AA Change: Q20R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140702
Gene: ENSMUSG00000037608
AA Change: Q20R

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 502 1.3e-140 PFAM
low complexity region 525 538 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215262
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that interacts with several members of the BCL2 family of proteins. Overexpression of this protein induces apoptosis, which can be suppressed by co-expression of BCL2 proteins. The protein localizes to dot-like structures throughout the nucleus, and redistributes to a zone near the nuclear envelope in cells undergoing apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, impaired lung development, and T cell and B cell homeostasis abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Bclaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bclaf1 APN 10 20325999 missense probably damaging 0.99
IGL01087:Bclaf1 APN 10 20325310 missense probably damaging 0.99
IGL02001:Bclaf1 APN 10 20323016 unclassified probably benign
IGL02380:Bclaf1 APN 10 20325367 missense possibly damaging 0.93
IGL02618:Bclaf1 APN 10 20323528 missense probably damaging 1.00
R0629:Bclaf1 UTSW 10 20333426 missense probably damaging 1.00
R0884:Bclaf1 UTSW 10 20322076 nonsense probably null
R1013:Bclaf1 UTSW 10 20332076 splice site probably benign
R1611:Bclaf1 UTSW 10 20323252 unclassified probably benign
R2228:Bclaf1 UTSW 10 20339878 utr 3 prime probably benign
R3689:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R3690:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R4292:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4831:Bclaf1 UTSW 10 20322126 unclassified probably benign
R5238:Bclaf1 UTSW 10 20332384 intron probably benign
R5254:Bclaf1 UTSW 10 20323536 missense possibly damaging 0.71
R5354:Bclaf1 UTSW 10 20333532 missense probably damaging 1.00
R5386:Bclaf1 UTSW 10 20325592 missense possibly damaging 0.95
R5712:Bclaf1 UTSW 10 20333531 missense probably damaging 1.00
R5982:Bclaf1 UTSW 10 20323063 nonsense probably null
R6147:Bclaf1 UTSW 10 20323425 missense possibly damaging 0.93
R6218:Bclaf1 UTSW 10 20334628 missense probably benign 0.27
R6284:Bclaf1 UTSW 10 20322160 intron probably null
R6738:Bclaf1 UTSW 10 20323769 missense possibly damaging 0.91
R7085:Bclaf1 UTSW 10 20322022 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTTAGTACAGTGCACTCTG -3'
(R):5'- GTTGTGAACTGATCGAAAATGGC -3'

Sequencing Primer
(F):5'- GTACAGTGCACTCTGCCAAAAATAC -3'
(R):5'- AACTGATCGAAAATGGCTAATAAAAC -3'
Posted On2015-06-20