Incidental Mutation 'R4290:Rps27a'
ID323020
Institutional Source Beutler Lab
Gene Symbol Rps27a
Ensembl Gene ENSMUSG00000020460
Gene Nameribosomal protein S27A
Synonyms
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29545846-29548109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29545933 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 140 (Y140H)
Ref Sequence ENSEMBL: ENSMUSP00000099909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020749] [ENSMUST00000020753] [ENSMUST00000093239] [ENSMUST00000102844] [ENSMUST00000102845] [ENSMUST00000208530]
Predicted Effect probably benign
Transcript: ENSMUST00000020749
SMART Domains Protein: ENSMUSP00000020749
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020753
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093239
SMART Domains Protein: ENSMUSP00000090926
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102844
AA Change: Y140H

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099908
Gene: ENSMUSG00000020460
AA Change: Y140H

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_S27 101 147 9.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102845
AA Change: Y140H

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099909
Gene: ENSMUSG00000020460
AA Change: Y140H

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_S27 102 147 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150739
Predicted Effect probably benign
Transcript: ENSMUST00000208530
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Rps27a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Rps27a APN 11 29546353 missense probably benign 0.03
IGL02189:Rps27a APN 11 29546772 missense probably damaging 0.99
R1834:Rps27a UTSW 11 29546299 missense probably benign 0.01
R1964:Rps27a UTSW 11 29547229 missense probably null 0.80
R6027:Rps27a UTSW 11 29547808 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCAAGTCTACAGGATATTCCAC -3'
(R):5'- TGTGAGATCAATAGCTTGAGTCAC -3'

Sequencing Primer
(F):5'- AAGAATTGACCTTAGTGCCTGCC -3'
(R):5'- GCTTGAGTCACTTAAATCAGGTTTC -3'
Posted On2015-06-20