Incidental Mutation 'R4290:Slc22a21'
ID323022
Institutional Source Beutler Lab
Gene Symbol Slc22a21
Ensembl Gene ENSMUSG00000063652
Gene Namesolute carrier family 22 (organic cation transporter), member 21
SynonymsOctn3, Slc22a9
MMRRC Submission 041655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4290 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53949965-53980332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53969503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000114966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076493] [ENSMUST00000124221] [ENSMUST00000143352]
Predicted Effect probably damaging
Transcript: ENSMUST00000076493
AA Change: D165G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075814
Gene: ENSMUSG00000063652
AA Change: D165G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 74 527 3.1e-31 PFAM
Pfam:MFS_1 139 376 3e-13 PFAM
low complexity region 528 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119198
Predicted Effect probably damaging
Transcript: ENSMUST00000124221
AA Change: D165G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123180
Gene: ENSMUSG00000063652
AA Change: D165G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143352
AA Change: D34G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,594,012 N1545S probably benign Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Arid3b A T 9: 57,790,430 probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Auts2 A G 5: 131,474,971 S225P probably damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cfap221 A G 1: 119,930,920 S728P probably benign Het
Chrna9 A G 5: 65,977,138 K444R probably benign Het
Cox10 A T 11: 63,964,255 V400E probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Ddr2 A G 1: 169,990,609 V443A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
En1 C A 1: 120,603,757 A242E unknown Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Hepacam2 T A 6: 3,487,237 Y40F probably benign Het
Ift80 A G 3: 68,963,690 I191T probably damaging Het
Il19 T A 1: 130,935,013 T58S possibly damaging Het
Itga2 G A 13: 114,866,173 R594C probably damaging Het
Itga5 C T 15: 103,352,257 probably null Het
Kcna1 T C 6: 126,641,875 D494G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kmt2b A T 7: 30,581,836 probably null Het
Kmt5b T C 19: 3,802,193 Y125H possibly damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Man1c1 T A 4: 134,563,785 D600V probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mettl5 T C 2: 69,880,832 N114S probably benign Het
Mindy2 T A 9: 70,631,094 R320W probably damaging Het
Nrip1 A G 16: 76,291,988 S894P probably benign Het
Nup210l A T 3: 90,207,326 H1736L probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1508 T C 14: 52,463,985 N8S probably damaging Het
Olfr169 A T 16: 19,566,244 M213K possibly damaging Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Olfr373 A G 8: 72,099,768 T3A probably benign Het
Olfr711 A C 7: 106,971,711 L211R probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Ppp4c A G 7: 126,792,059 probably null Het
Rps15a-ps1 A G 10: 106,192,635 noncoding transcript Het
Rps27a A G 11: 29,545,933 Y140H probably benign Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tmem237 A G 1: 59,119,836 probably benign Het
Ttc19 A G 11: 62,285,927 probably null Het
Ttf2 T C 3: 100,962,761 D332G probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vcan A G 13: 89,725,486 V83A probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Xndc1 T A 7: 102,081,487 L288M possibly damaging Het
Zfa-ps A T 10: 52,543,711 noncoding transcript Het
Other mutations in Slc22a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Slc22a21 APN 11 53979581 missense probably damaging 1.00
R0025:Slc22a21 UTSW 11 53979688 missense probably damaging 1.00
R0104:Slc22a21 UTSW 11 53951809 missense probably null 0.88
R0285:Slc22a21 UTSW 11 53959196 splice site probably benign
R0562:Slc22a21 UTSW 11 53979620 nonsense probably null
R0569:Slc22a21 UTSW 11 53951810 missense probably benign 0.00
R1237:Slc22a21 UTSW 11 53979772 missense probably benign 0.36
R2131:Slc22a21 UTSW 11 53979733 missense probably damaging 1.00
R2327:Slc22a21 UTSW 11 53951304 missense probably benign 0.25
R2991:Slc22a21 UTSW 11 53959369 missense probably damaging 1.00
R4209:Slc22a21 UTSW 11 53956055 missense probably benign 0.00
R4291:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4292:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4294:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4295:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4470:Slc22a21 UTSW 11 53956013 missense probably benign 0.00
R5194:Slc22a21 UTSW 11 53979847 missense probably damaging 1.00
R5214:Slc22a21 UTSW 11 53953043 missense probably damaging 0.99
R5698:Slc22a21 UTSW 11 53951349 missense probably benign 0.04
R6169:Slc22a21 UTSW 11 53958087 missense probably damaging 1.00
R6200:Slc22a21 UTSW 11 53958038 missense probably damaging 1.00
R6767:Slc22a21 UTSW 11 53979502 missense probably damaging 1.00
R6845:Slc22a21 UTSW 11 53979640 missense probably benign 0.01
R7109:Slc22a21 UTSW 11 53979503 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACTGACTCAGGTTCCTTTGTTCAG -3'
(R):5'- AGAGGCCACCTGTTTTCTCTG -3'

Sequencing Primer
(F):5'- ACTCAGGTTCCTTTGTTCAGTGAGG -3'
(R):5'- CATTGCTGCCCAGGTGAGTC -3'
Posted On2015-06-20