Incidental Mutation 'R4291:Arid1b'
ID323086
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission 041081-MU
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5040663 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 546 (S546R)
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably damaging
Transcript: ENSMUST00000092723
AA Change: S546R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: S546R

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115797
AA Change: S494R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: S494R

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115799
AA Change: S42R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: S42R

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156775
Predicted Effect probably damaging
Transcript: ENSMUST00000232180
AA Change: S546R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Pcdhb1 A C 18: 37,265,417 L140F probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGTACTTGGAATCAAAATCGTG -3'
(R):5'- GGGGATATCACAGAAACATCCC -3'

Sequencing Primer
(F):5'- CTTGGAATCAAAATCGTGTTTCCTG -3'
(R):5'- GGATATCACAGAAACATCCCCAAATC -3'
Posted On2015-06-20