Incidental Mutation 'R4292:Angel1'
ID323131
Institutional Source Beutler Lab
Gene Symbol Angel1
Ensembl Gene ENSMUSG00000021257
Gene Nameangel homolog 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R4292 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location86700502-86726460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86720283 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 440 (Y440H)
Ref Sequence ENSEMBL: ENSMUSP00000021682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021682]
Predicted Effect probably damaging
Transcript: ENSMUST00000021682
AA Change: Y440H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021682
Gene: ENSMUSG00000021257
AA Change: Y440H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Exo_endo_phos 245 653 4.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171293
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,795,996 K1232E possibly damaging Het
Bclaf1 A G 10: 20,323,778 Q20R probably damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cep68 A T 11: 20,240,079 V311D probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gcn1l1 G A 5: 115,576,148 A116T possibly damaging Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hddc2 A T 10: 31,314,587 M48L possibly damaging Het
Kif18a A T 2: 109,298,126 I376L probably damaging Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Myh2 A G 11: 67,194,897 K1855R possibly damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr1450 G A 19: 12,954,156 C189Y possibly damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Pdss2 A G 10: 43,221,838 Y26C probably benign Het
Pgm2l1 A G 7: 100,250,301 T41A probably damaging Het
Prss58 T C 6: 40,897,310 D144G probably damaging Het
Rrp12 T C 19: 41,872,905 probably null Het
Sash1 A G 10: 8,730,242 S795P possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Slco4c1 C G 1: 96,844,656 probably null Het
Srsf6 T C 2: 162,934,716 probably benign Het
Tgfb2 T C 1: 186,632,538 H253R probably damaging Het
Top3b A T 16: 16,883,519 I232F probably damaging Het
Trim24 G A 6: 37,900,692 R39H possibly damaging Het
Tsc22d1 T A 14: 76,418,880 M851K probably benign Het
Ttn A G 2: 76,932,511 V3268A possibly damaging Het
Unc79 A T 12: 103,183,444 Q2599L probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Other mutations in Angel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Angel1 APN 12 86717026 missense probably benign
IGL02712:Angel1 APN 12 86722839 splice site probably benign
IGL02738:Angel1 APN 12 86705286 missense probably benign 0.10
R0521:Angel1 UTSW 12 86722907 missense probably benign 0.01
R0626:Angel1 UTSW 12 86717713 critical splice donor site probably null
R1929:Angel1 UTSW 12 86702319 missense probably damaging 1.00
R4291:Angel1 UTSW 12 86720283 missense probably damaging 1.00
R4295:Angel1 UTSW 12 86720283 missense probably damaging 1.00
R4450:Angel1 UTSW 12 86721924 missense probably damaging 1.00
R4726:Angel1 UTSW 12 86721875 missense probably damaging 0.99
R7097:Angel1 UTSW 12 86726384 missense probably damaging 0.98
R7284:Angel1 UTSW 12 86720524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGAATCGCTTGCAAAC -3'
(R):5'- GTGTGGCAAATACCCATGTC -3'

Sequencing Primer
(F):5'- GCCCGAGGTATTCATGTGC -3'
(R):5'- GTGGCAAATACCCATGTCCTGTAC -3'
Posted On2015-06-20