Mutagenetix > Incidental Mutation

Incidental Mutation 'R4293:Slfn10-ps'

323179

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

041082-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4293 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82919681-82926992 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 82926260 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Meta Mutation Damage Score

0.3175

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.2%

Validation Efficiency

98% (60/61)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn3	T	C	19: 4,915,468 (GRCm39)	E428G	probably benign	Het
Arfgef2	T	C	2: 166,732,211 (GRCm39)	I1600T	probably benign	Het
Arid3b	A	T	9: 57,697,713 (GRCm39)		probably benign	Het
Asgr2	C	A	11: 69,989,057 (GRCm39)	T167K	probably benign	Het
Atf6b	T	A	17: 34,871,648 (GRCm39)	M428K	probably benign	Het
Atpaf1	A	T	4: 115,645,556 (GRCm39)	M142L	probably benign	Het
Bivm	A	T	1: 44,177,793 (GRCm39)	R364S	probably damaging	Het
Bms1	T	C	6: 118,382,308 (GRCm39)		probably null	Het
Brwd1	G	A	16: 95,818,804 (GRCm39)	P1343S	probably damaging	Het
Cdca2	T	C	14: 67,952,299 (GRCm39)	D24G	probably benign	Het
Celsr2	T	C	3: 108,300,993 (GRCm39)	R2767G	probably benign	Het
Cip2a	T	A	16: 48,833,612 (GRCm39)	F571Y	probably benign	Het
Cyp2c55	A	T	19: 39,000,235 (GRCm39)	I145F	probably damaging	Het
Ddx18	T	C	1: 121,489,121 (GRCm39)	T309A	probably benign	Het
Dlg3	A	T	X: 99,840,288 (GRCm39)		probably benign	Het
Fbf1	A	G	11: 116,039,720 (GRCm39)	L713P	probably damaging	Het
Fhdc1	C	A	3: 84,352,133 (GRCm39)	V1031F	probably benign	Het
Fnbp1	A	G	2: 30,995,362 (GRCm39)	F24S	probably damaging	Het
Gm16686	A	T	4: 88,673,710 (GRCm39)		probably benign	Het
Gmps	A	G	3: 63,898,040 (GRCm39)	M275V	probably damaging	Het
Igdcc4	A	G	9: 65,031,892 (GRCm39)		probably null	Het
Kcnv1	G	A	15: 44,977,840 (GRCm39)	T66M	probably damaging	Het
Kif18a	T	C	2: 109,123,398 (GRCm39)	V224A	probably benign	Het
Lbr	C	T	1: 181,648,267 (GRCm39)	C398Y	probably damaging	Het
Lmf1	T	C	17: 25,873,455 (GRCm39)	L320P	probably damaging	Het
Mapkapk3	T	C	9: 107,136,131 (GRCm39)		probably benign	Het
Mettl18	A	G	1: 163,824,171 (GRCm39)	D164G	probably damaging	Het
Myo5a	A	T	9: 75,051,453 (GRCm39)	T349S	probably benign	Het
Or1ad6	T	C	11: 50,860,253 (GRCm39)	M136T	probably damaging	Het
Or8d2b	A	G	9: 38,788,609 (GRCm39)	I46V	probably damaging	Het
Pcdhb5	T	A	18: 37,455,734 (GRCm39)	S705T	possibly damaging	Het
Phf14	C	T	6: 11,987,096 (GRCm39)	P559S	probably damaging	Het
Pik3c3	G	A	18: 30,477,043 (GRCm39)	A855T	probably damaging	Het
Plpp4	A	G	7: 128,909,356 (GRCm39)	E22G	probably damaging	Het
Rev1	A	T	1: 38,147,500 (GRCm39)	D13E	possibly damaging	Het
Sec16a	A	G	2: 26,312,167 (GRCm39)	Y1998H	probably benign	Het
Slc4a5	C	T	6: 83,237,511 (GRCm39)	R165C	probably damaging	Het
Slfn9	T	C	11: 82,873,334 (GRCm39)	N523S	probably benign	Het
Spata13	T	A	14: 60,947,004 (GRCm39)	M684K	probably damaging	Het
Srsf6	T	C	2: 162,776,636 (GRCm39)		probably benign	Het
Stk32c	T	C	7: 138,700,704 (GRCm39)		probably null	Het
Tenm3	T	C	8: 48,848,693 (GRCm39)	T49A	probably damaging	Het
Tep1	T	C	14: 51,084,318 (GRCm39)	I954V	probably benign	Het
Tmem237	A	G	1: 59,158,995 (GRCm39)		probably benign	Het
Vmn2r101	A	T	17: 19,832,303 (GRCm39)	R766S	probably damaging	Het
Vwce	A	G	19: 10,636,996 (GRCm39)	T693A	probably benign	Het
Xpr1	A	G	1: 155,188,542 (GRCm39)	F366S	possibly damaging	Het
Zfp317	A	G	9: 19,557,990 (GRCm39)		probably null	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	82,926,085 (GRCm39)	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	82,926,353 (GRCm39)	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	82,926,322 (GRCm39)	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	82,926,761 (GRCm39)	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	82,919,938 (GRCm39)	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	82,923,016 (GRCm39)	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	82,919,890 (GRCm39)	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	82,923,117 (GRCm39)	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	82,921,090 (GRCm39)	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	82,920,971 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	82,926,128 (GRCm39)	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	82,926,600 (GRCm39)	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	82,920,360 (GRCm39)	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	82,926,479 (GRCm39)	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	82,926,388 (GRCm39)	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	82,926,235 (GRCm39)	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	82,920,676 (GRCm39)	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	82,920,869 (GRCm39)	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	82,921,168 (GRCm39)	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	82,926,511 (GRCm39)	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	82,919,756 (GRCm39)	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	82,919,955 (GRCm39)	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	82,920,345 (GRCm39)	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	82,921,207 (GRCm39)	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	82,921,341 (GRCm39)	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	82,919,851 (GRCm39)	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	82,926,113 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GGCTCTACTTTGATCACACAGAG -3'
(R):5'- AGGAGCCATGTATCAGAACAGC -3'

Sequencing Primer
(F):5'- TCTACTTTGATCACACAGAGATAACC -3'
(R):5'- CAGCCTTGAAACAAATCCAGCTTTTG -3'

Posted On

2015-06-20