Incidental Mutation 'R4296:Midn'
ID323337
Institutional Source Beutler Lab
Gene Symbol Midn
Ensembl Gene ENSMUSG00000035621
Gene Namemidnolin
Synonyms
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80148272-80158368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80151719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 21 (T21I)
Ref Sequence ENSEMBL: ENSMUSP00000119787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042057] [ENSMUST00000099492] [ENSMUST00000144526] [ENSMUST00000146516] [ENSMUST00000151202] [ENSMUST00000153477]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042057
AA Change: T128I

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046967
Gene: ENSMUSG00000035621
AA Change: T128I

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 130 143 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 238 262 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 434 453 N/A INTRINSIC
low complexity region 465 485 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099492
AA Change: T128I

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097091
Gene: ENSMUSG00000035621
AA Change: T128I

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 154 168 N/A INTRINSIC
low complexity region 195 219 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124179
Predicted Effect probably damaging
Transcript: ENSMUST00000144526
AA Change: T21I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120988
Gene: ENSMUSG00000035621
AA Change: T21I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146516
AA Change: T21I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119962
Gene: ENSMUSG00000035621
AA Change: T21I

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 88 112 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151202
SMART Domains Protein: ENSMUSP00000115717
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
Blast:UBQ 32 67 4e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000153477
AA Change: T21I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119787
Gene: ENSMUSG00000035621
AA Change: T21I

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains an ubiquitin-like domain. This protein may be involved in the regulation of brain development as inferred by its high expression level in the embryonic midbrain. This protein has been found to negatively regulate glucokinase activity and insulin secretion in pancreatic beta cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate and small ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Midn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Midn APN 10 80156643 unclassified probably benign
IGL01969:Midn APN 10 80155259 missense probably benign 0.00
IGL02824:Midn APN 10 80153652 missense possibly damaging 0.91
Midnight UTSW 10 80154457 missense probably damaging 0.98
Sepia UTSW 10 80151404 missense probably null 0.26
R0684:Midn UTSW 10 80156502 missense probably damaging 1.00
R1517:Midn UTSW 10 80154123 missense probably damaging 0.96
R1926:Midn UTSW 10 80151661 missense probably damaging 1.00
R2004:Midn UTSW 10 80155149 missense probably benign 0.13
R2016:Midn UTSW 10 80150115 missense possibly damaging 0.91
R2340:Midn UTSW 10 80150112 missense possibly damaging 0.66
R2483:Midn UTSW 10 80150310 missense probably benign 0.16
R3622:Midn UTSW 10 80150310 missense probably benign 0.16
R3624:Midn UTSW 10 80150310 missense probably benign 0.16
R4740:Midn UTSW 10 80151404 missense probably null 0.26
R4930:Midn UTSW 10 80155355 missense probably benign
R4977:Midn UTSW 10 80150184 missense probably damaging 1.00
R5423:Midn UTSW 10 80155193 missense probably benign 0.15
R6149:Midn UTSW 10 80154457 missense probably damaging 0.98
R6542:Midn UTSW 10 80156584 missense probably damaging 0.97
R6826:Midn UTSW 10 80154127 nonsense probably null
X0018:Midn UTSW 10 80153997 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCAAAGAGCTCTCCCACTG -3'
(R):5'- TGTCTCAAGGTCAGGTGGTC -3'

Sequencing Primer
(F):5'- AGCTCTCCCACTGCCCCTAG -3'
(R):5'- CTCAAGGTCAGGTGGTCAGGTG -3'
Posted On2015-06-20