Incidental Mutation 'R4296:Vezt'
ID323340
Institutional Source Beutler Lab
Gene Symbol Vezt
Ensembl Gene ENSMUSG00000036099
Gene Namevezatin, adherens junctions transmembrane protein
Synonyms
MMRRC Submission 041656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4296 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location93939165-94035817 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACTCCTCCT to ACTCCT at 93973931 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000047711] [ENSMUST00000118077] [ENSMUST00000118205] [ENSMUST00000119818]
Predicted Effect probably benign
Transcript: ENSMUST00000047711
SMART Domains Protein: ENSMUSP00000037955
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1.6e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
low complexity region 702 715 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118077
SMART Domains Protein: ENSMUSP00000113983
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 9.2e-61 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118205
SMART Domains Protein: ENSMUSP00000113321
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119818
SMART Domains Protein: ENSMUSP00000113715
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 150 442 1e-93 PFAM
low complexity region 570 585 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 768 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148450
SMART Domains Protein: ENSMUSP00000121105
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is essential for the formation of adherens junctions. It is required for both the pre-implantation morphogenesis of a blastocyst and for the implantation process. The encoded protein is also a component of the ankle-link complex in cochlear hair cells, where it may effect resilience to sound trauma. It is also thought to be involved in dendritic spine morphogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele develop to the blastocyst stage inducing a decidual response but die at implantation. Only about half of blastocysts are able to hatch upon in vitro culture and mutant outgrowths show severe defects in intercellular adhesion and signs of cellular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nlrp3 A T 11: 59,549,661 E688V possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Vezt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Vezt APN 10 93996857 missense probably damaging 1.00
IGL01655:Vezt APN 10 93996997 missense probably benign 0.00
IGL02014:Vezt APN 10 93996949 missense probably benign 0.35
IGL03072:Vezt APN 10 93974033 missense probably damaging 1.00
R0542:Vezt UTSW 10 94007096 critical splice acceptor site probably null
R1633:Vezt UTSW 10 93984276 missense probably damaging 1.00
R1757:Vezt UTSW 10 93970563 missense probably benign
R1808:Vezt UTSW 10 93990164 missense probably damaging 1.00
R4972:Vezt UTSW 10 94000350 critical splice donor site probably null
R5079:Vezt UTSW 10 94020624 splice site probably null
R5137:Vezt UTSW 10 93970510 missense probably benign 0.00
R5319:Vezt UTSW 10 93970331 missense probably benign
R5743:Vezt UTSW 10 93997095 missense probably benign 0.01
R6002:Vezt UTSW 10 94000474 missense probably damaging 1.00
R6281:Vezt UTSW 10 93973946 missense probably benign 0.04
R6652:Vezt UTSW 10 93970279 missense probably damaging 1.00
R6681:Vezt UTSW 10 93996997 missense probably benign 0.00
R6914:Vezt UTSW 10 93970451 missense probably benign
R7100:Vezt UTSW 10 93996933 missense probably benign 0.13
R7131:Vezt UTSW 10 93970547 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGAGTCCTGTACTGACCG -3'
(R):5'- TAGCGCAAGTAGTGAGTACTGC -3'

Sequencing Primer
(F):5'- AGTCCTGTACTGACCGGAGGATC -3'
(R):5'- AGTACTGCTCAGAGACCTGTTG -3'
Posted On2015-06-20