Incidental Mutation 'R4296:Nlrp3'
ID323344
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene NameNLR family, pyrin domain containing 3
SynonymsCias1, cryopyrin, Pypaf1, NALP3, Mmig1
MMRRC Submission 041656-MU
Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4296 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59541568-59566956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59549661 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 688 (E688V)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: E688V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: E688V

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: E688V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: E688V

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G T 19: 43,823,074 G993C probably damaging Het
Abcc2 G C 19: 43,823,075 G993A probably damaging Het
Abi3bp A T 16: 56,668,310 H810L probably benign Het
Aldh1l2 T C 10: 83,522,777 D5G probably benign Het
Aldh7a1 A T 18: 56,544,963 probably null Het
Aox1 T A 1: 58,057,400 probably null Het
Apbb1 G T 7: 105,573,826 Q193K probably benign Het
Arl9 C A 5: 77,006,549 N41K probably damaging Het
Armc1 A G 3: 19,149,516 M82T probably damaging Het
Bms1 T C 6: 118,404,999 E526G probably damaging Het
Cacna1a C T 8: 84,559,293 R809C probably damaging Het
Cd200r1 T C 16: 44,789,670 I84T probably damaging Het
Cgrrf1 T C 14: 46,832,355 V27A probably damaging Het
Clec4f G A 6: 83,652,575 Q334* probably null Het
Cpeb3 C T 19: 37,173,989 G329D possibly damaging Het
Ctnnbl1 C T 2: 157,819,570 probably null Het
Dip2b A T 15: 100,181,336 M810L probably benign Het
Eml3 T C 19: 8,931,409 S158P probably damaging Het
Eps8l2 G T 7: 141,358,262 E470* probably null Het
Flt3l A G 7: 45,134,004 F146S probably damaging Het
Glmn A T 5: 107,558,502 V419E possibly damaging Het
Gm11360 T A 13: 27,956,312 I53N probably damaging Het
Gpbp1l1 T A 4: 116,587,459 V275D possibly damaging Het
Harbi1 T A 2: 91,712,755 M187K possibly damaging Het
Has3 T C 8: 106,878,422 V420A possibly damaging Het
Huwe1 C A X: 151,888,448 T1012K probably benign Het
Iqcg G A 16: 33,016,975 probably benign Het
Itga4 G A 2: 79,272,799 G111R probably damaging Het
Keap1 A G 9: 21,233,986 S243P probably damaging Het
Kmt2a C T 9: 44,821,175 probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Ltbp3 A T 19: 5,756,582 probably null Het
Mbtps1 C T 8: 119,522,499 C684Y possibly damaging Het
Mcm3ap A T 10: 76,507,337 I1688F probably damaging Het
Midn C T 10: 80,151,719 T21I probably damaging Het
Naf1 C T 8: 66,889,462 P580S possibly damaging Het
Nusap1 A G 2: 119,639,648 H259R probably damaging Het
Nxpe4 A G 9: 48,398,984 T516A probably damaging Het
Oas1g T A 5: 120,879,167 T275S probably damaging Het
Ogdh T G 11: 6,349,374 F743V probably damaging Het
Olfr1109 T C 2: 87,092,630 T256A probably benign Het
Olfr1505 A G 19: 13,919,353 E111G probably damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr790 C A 10: 129,501,470 C195* probably null Het
Olfr811 C A 10: 129,802,300 C75F probably damaging Het
Pdzd3 G A 9: 44,248,861 R349C probably benign Het
Peg10 GGAT GGATCCCCATCATGAT 6: 4,756,472 probably benign Het
Piezo1 T A 8: 122,491,127 Y819F probably damaging Het
Plekhg2 C A 7: 28,371,166 G20C probably damaging Het
Polq A G 16: 37,061,301 T997A possibly damaging Het
Polr3a T A 14: 24,453,196 Q1190L possibly damaging Het
Ppp1r15a T A 7: 45,523,749 K800* probably null Het
Prkdc T A 16: 15,737,905 M2181K probably damaging Het
Pskh1 C A 8: 105,912,904 A72E probably benign Het
Purg T C 8: 33,387,293 Y320H probably damaging Het
Rab3gap2 T A 1: 185,255,837 probably null Het
Rnps1 T A 17: 24,425,115 probably benign Het
Scgb2b21 A T 7: 33,519,808 V57E probably benign Het
Sdhaf2 A T 19: 10,525,075 I7N probably benign Het
Six4 A G 12: 73,104,125 Y549H probably damaging Het
Slc4a10 G T 2: 62,234,428 V209F possibly damaging Het
Slc4a11 C A 2: 130,685,007 V734F probably benign Het
Stk4 T A 2: 164,117,984 M27K possibly damaging Het
Tecrl A T 5: 83,313,327 C79* probably null Het
Tgm3 G T 2: 130,038,413 V380L possibly damaging Het
Tiam2 A T 17: 3,450,845 M920L probably benign Het
Tjp1 T C 7: 65,318,489 N729S probably damaging Het
Tlr12 A G 4: 128,617,788 L223P probably damaging Het
Tmem268 T C 4: 63,565,768 probably null Het
Tmpo A T 10: 91,162,956 I323K possibly damaging Het
Tmx4 T C 2: 134,598,629 S302G probably benign Het
Trip11 C A 12: 101,885,868 E361* probably null Het
Tspyl3 T A 2: 153,225,156 N54I possibly damaging Het
Upp2 A T 2: 58,778,009 Y220F probably damaging Het
Usp22 G T 11: 61,161,464 probably null Het
Vezt ACTCCTCCT ACTCCT 10: 93,973,931 probably benign Het
Vmn1r235 G T 17: 21,262,300 G296W probably damaging Het
Vmn1r89 T C 7: 13,220,186 V94A possibly damaging Het
Zfp607a A T 7: 27,865,648 E80V probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
nd7 UTSW 11 59555875 missense possibly damaging 0.89
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TACTGCCTGTACGAGATGCAG -3'
(R):5'- TGGCAGTCACATTATCATGAAGC -3'

Sequencing Primer
(F):5'- TGCAGGAGGAAGACTTTGTGC -3'
(R):5'- TCAGAAATAGAGGAGAGGAAAGAAAG -3'
Posted On2015-06-20