Incidental Mutation 'R4297:Vcam1'
ID323382
Institutional Source Beutler Lab
Gene Symbol Vcam1
Ensembl Gene ENSMUSG00000027962
Gene Namevascular cell adhesion molecule 1
SynonymsVcam-1, CD106
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116109949-116129688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116117243 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 502 (V502E)
Ref Sequence ENSEMBL: ENSMUSP00000029574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029574]
Predicted Effect probably benign
Transcript: ENSMUST00000029574
AA Change: V502E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029574
Gene: ENSMUSG00000027962
AA Change: V502E

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 4.5e-27 PFAM
IGc2 237 298 2.09e-15 SMART
IGc2 326 390 8.38e-6 SMART
Pfam:C2-set 421 509 7.2e-26 PFAM
IGc2 525 586 7.35e-11 SMART
IG 608 686 2.25e-6 SMART
transmembrane domain 699 721 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197031
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ig superfamily and encodes a cell surface sialoglycoprotein expressed by cytokine-activated endothelium. This type I membrane protein mediates leukocyte-endothelial cell adhesion and signal transduction, and may play a role in the development of artherosclerosis and rheumatoid arthritis. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Most homozygous null mutants die by embryonic day 12.5 due to defective placenta and failure of chorion/allantois fusion, and heart developmental anomalies. Survivors are generally normal, but have high numbers of circulating blood mononuclear leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Vcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Vcam1 APN 3 116114471 missense possibly damaging 0.85
IGL01546:Vcam1 APN 3 116115942 missense possibly damaging 0.86
IGL01548:Vcam1 APN 3 116115951 missense probably benign 0.06
IGL02070:Vcam1 APN 3 116125997 missense probably benign 0.07
IGL02353:Vcam1 APN 3 116115894 missense possibly damaging 0.53
IGL02360:Vcam1 APN 3 116115894 missense possibly damaging 0.53
K7371:Vcam1 UTSW 3 116124649 missense probably benign 0.00
R0310:Vcam1 UTSW 3 116114416 missense possibly damaging 0.93
R0319:Vcam1 UTSW 3 116116060 missense probably benign 0.01
R0468:Vcam1 UTSW 3 116115946 nonsense probably null
R0638:Vcam1 UTSW 3 116117259 missense possibly damaging 0.71
R1070:Vcam1 UTSW 3 116110903 missense possibly damaging 0.96
R1728:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1784:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1956:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R1957:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R3052:Vcam1 UTSW 3 116124430 unclassified probably null
R3832:Vcam1 UTSW 3 116114491 missense possibly damaging 0.71
R4801:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4802:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4970:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5073:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5074:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5112:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5597:Vcam1 UTSW 3 116126002 missense probably damaging 0.99
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6120:Vcam1 UTSW 3 116124400 missense probably damaging 0.99
R6617:Vcam1 UTSW 3 116126062 missense possibly damaging 0.48
R7232:Vcam1 UTSW 3 116125979 missense possibly damaging 0.71
R7350:Vcam1 UTSW 3 116114562 missense probably damaging 0.99
R7384:Vcam1 UTSW 3 116117228 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCAGTCCTGAATGCTAATGC -3'
(R):5'- GTGTATCCCTTTGACCATCTGG -3'

Sequencing Primer
(F):5'- AATTTGGTTTGCTTTATGGAGAATG -3'
(R):5'- CCATCTGGAGATTGAATTACTGAAGG -3'
Posted On2015-06-20