Incidental Mutation 'R4297:Hbb-bs'
ID323389
Institutional Source Beutler Lab
Gene Symbol Hbb-bs
Ensembl Gene ENSMUSG00000052305
Gene Namehemoglobin, beta adult s chain
Synonymsbeta s
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103826534-103828096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103826744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000023934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023934] [ENSMUST00000153218]
Predicted Effect probably benign
Transcript: ENSMUST00000023934
AA Change: D122G

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023934
Gene: ENSMUSG00000052305
AA Change: D122G

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131960
Predicted Effect probably benign
Transcript: ENSMUST00000153218
SMART Domains Protein: ENSMUSP00000115607
Gene: ENSMUSG00000052305

DomainStartEndE-ValueType
Pfam:Globin 8 103 3.8e-29 PFAM
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
MGI Phenotype FUNCTION: This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta s adult gene found in the "single" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Hbb-bs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Hbb-bs APN 7 103827884 splice site probably benign
IGL03120:Hbb-bs APN 7 103827778 splice site probably benign
R0219:Hbb-bs UTSW 7 103826669 missense possibly damaging 0.78
R2243:Hbb-bs UTSW 7 103827811 missense possibly damaging 0.51
R4921:Hbb-bs UTSW 7 103826720 missense probably damaging 0.98
R5802:Hbb-bs UTSW 7 103826672 missense probably damaging 1.00
R6908:Hbb-bs UTSW 7 103827534 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTAGCATAAACCCTTCTATGACAC -3'
(R):5'- CTTTTATGCCAGGGTGACAGGG -3'

Sequencing Primer
(F):5'- ACATCATTGCAGTGAAATAAATGC -3'
(R):5'- GGTGACAGGGGAAGAATATATTTTAC -3'
Posted On2015-06-20