Incidental Mutation 'R4297:Fpr-rs3'
ID323399
Institutional Source Beutler Lab
Gene Symbol Fpr-rs3
Ensembl Gene ENSMUSG00000060701
Gene Nameformyl peptide receptor, related sequence 3
Synonyms
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20623846-20624877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20624746 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 44 (N44K)
Ref Sequence ENSEMBL: ENSMUSP00000071179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071189]
Predicted Effect probably damaging
Transcript: ENSMUST00000071189
AA Change: N44K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071179
Gene: ENSMUSG00000060701
AA Change: N44K

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.8e-36 PFAM
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Epcam T C 17: 87,640,534 probably null Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Fpr-rs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Fpr-rs3 APN 17 20624597 missense probably damaging 1.00
IGL02230:Fpr-rs3 APN 17 20623928 missense probably damaging 1.00
IGL02503:Fpr-rs3 APN 17 20624555 missense probably damaging 1.00
IGL02809:Fpr-rs3 APN 17 20623963 missense probably damaging 0.99
IGL03212:Fpr-rs3 APN 17 20623859 missense probably benign 0.00
I2288:Fpr-rs3 UTSW 17 20624495 missense probably damaging 0.99
R0318:Fpr-rs3 UTSW 17 20624148 missense probably benign 0.02
R0565:Fpr-rs3 UTSW 17 20624021 missense probably damaging 1.00
R1005:Fpr-rs3 UTSW 17 20624084 missense probably benign 0.04
R1986:Fpr-rs3 UTSW 17 20623841 unclassified probably null
R3941:Fpr-rs3 UTSW 17 20624849 missense probably benign 0.42
R4809:Fpr-rs3 UTSW 17 20624421 missense probably benign 0.00
R4959:Fpr-rs3 UTSW 17 20623949 missense possibly damaging 0.73
R4973:Fpr-rs3 UTSW 17 20623949 missense possibly damaging 0.73
R5116:Fpr-rs3 UTSW 17 20624300 missense probably benign 0.12
R5356:Fpr-rs3 UTSW 17 20624334 missense probably damaging 0.98
R5394:Fpr-rs3 UTSW 17 20624208 missense probably benign 0.00
R5779:Fpr-rs3 UTSW 17 20624226 missense possibly damaging 0.53
R6091:Fpr-rs3 UTSW 17 20624270 missense probably benign 0.30
R6389:Fpr-rs3 UTSW 17 20623968 missense probably damaging 0.96
R6860:Fpr-rs3 UTSW 17 20624298 missense possibly damaging 0.68
X0018:Fpr-rs3 UTSW 17 20624637 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GTGCACAATGCTGAGAACAAATTTG -3'
(R):5'- TGTGGAATCTGAGTAAGAGTGC -3'

Sequencing Primer
(F):5'- CTGAGAACAAATTTGCAAAGGAACC -3'
(R):5'- GTGCTGTATATTAGAGCCACAACTG -3'
Posted On2015-06-20