Incidental Mutation 'R4297:Epcam'
ID323400
Institutional Source Beutler Lab
Gene Symbol Epcam
Ensembl Gene ENSMUSG00000045394
Gene Nameepithelial cell adhesion molecule
SynonymsGA733-2, Egp314, EpCAM, gp40, Ly74, EGP-2, CD326, panepithelial glycoprotein 314, TROP1, Ep-CAM, EpCAM1, Tacstd1
MMRRC Submission 041085-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4297 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location87635979-87651106 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 87640534 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053577] [ENSMUST00000053577]
Predicted Effect probably null
Transcript: ENSMUST00000053577
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053577
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Meta Mutation Damage Score 0.6212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 85% (33/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with decreased embryo size, impaired labyrinth layer development and decreased number of trophoblast giant cells. Mice homozygous for another knock-out allele exhibit impaired intestinal tight junctions with lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Alkbh3 C T 2: 94,008,124 R34H probably benign Het
Cacna1e T G 1: 154,398,731 S2143R probably benign Het
Camkk2 A G 5: 122,745,706 probably null Het
Cep295 A G 9: 15,322,654 V2282A probably benign Het
Cfap46 A C 7: 139,652,673 D827E probably benign Het
Col5a1 T C 2: 28,017,204 probably null Het
Col6a3 T A 1: 90,811,378 E376V probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp2a4 A G 7: 26,307,368 T51A probably damaging Het
Dgke A T 11: 89,050,730 V273D probably damaging Het
Fpr-rs3 A T 17: 20,624,746 N44K probably damaging Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gm6818 A T 7: 38,402,453 noncoding transcript Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Gsto2 A C 19: 47,876,496 E156A possibly damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Mc5r T C 18: 68,339,307 F246L probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a21 G A 7: 45,287,762 V239M possibly damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Ttn C A 2: 76,726,263 G30133C probably damaging Het
Ugt1a8 T C 1: 88,088,104 S80P probably benign Het
Vax1 G T 19: 59,166,251 S318* probably null Het
Vcam1 A T 3: 116,117,243 V502E probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Vps18 T A 2: 119,297,331 C878* probably null Het
Wdr11 A G 7: 129,625,186 R791G probably benign Het
Other mutations in Epcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02739:Epcam APN 17 87640494 missense probably benign 0.30
R0664:Epcam UTSW 17 87639970 missense possibly damaging 0.86
R1612:Epcam UTSW 17 87639938 missense possibly damaging 0.87
R1693:Epcam UTSW 17 87639896 missense probably benign
R1719:Epcam UTSW 17 87642128 missense probably damaging 1.00
R1998:Epcam UTSW 17 87640474 missense probably damaging 1.00
R3872:Epcam UTSW 17 87639926 missense possibly damaging 0.79
R4298:Epcam UTSW 17 87640534 splice site probably null
R4866:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R4900:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R5091:Epcam UTSW 17 87642152 missense probably damaging 1.00
R5301:Epcam UTSW 17 87636877 missense possibly damaging 0.92
R6207:Epcam UTSW 17 87640436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTGGCGATGAAAGCAG -3'
(R):5'- AGGATGGACACTTGTCACTCC -3'

Sequencing Primer
(F):5'- TTGGCGATGAAAGCAGAAATGACTC -3'
(R):5'- TGGACACTTGTCACTCCAAAAGGG -3'
Posted On2015-06-20