Mutagenetix > Incidental Mutation

Incidental Mutation 'R4298:Reln'

323421

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

041086-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R4298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22089452-22549700 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 22125485 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 2733 (C2733G)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: C2733G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: C2733G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084713

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159768

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: C2733G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: C2733G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Meta Mutation Damage Score

0.8547

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 87,258,154 (GRCm39)		probably null	Het
Ccser2	T	A	14: 36,612,337 (GRCm39)	Q158L	possibly damaging	Het
Cct7	T	A	6: 85,445,155 (GRCm39)	C469S	probably damaging	Het
Chmp7	A	T	14: 69,956,650 (GRCm39)		probably null	Het
Clcn4	C	T	7: 7,299,737 (GRCm39)	D31N	possibly damaging	Het
Col9a2	C	G	4: 120,911,455 (GRCm39)	R599G	probably damaging	Het
Ctdp1	A	T	18: 80,493,172 (GRCm39)	V441E	probably benign	Het
Cyp4a10	T	C	4: 115,389,889 (GRCm39)	L498P	probably damaging	Het
Dsc3	A	T	18: 20,113,811 (GRCm39)	N370K	possibly damaging	Het
Dusp12	G	A	1: 170,708,198 (GRCm39)	T173M	probably benign	Het
Ebf3	C	T	7: 136,826,958 (GRCm39)	R318Q	possibly damaging	Het
Epcam	T	C	17: 87,947,962 (GRCm39)		probably null	Het
Erich6	G	T	3: 58,531,712 (GRCm39)	A428D	probably benign	Het
Ext1	A	T	15: 53,208,521 (GRCm39)	I80N	probably benign	Het
Extl1	T	C	4: 134,084,969 (GRCm39)	E667G	probably damaging	Het
F2	T	G	2: 91,459,665 (GRCm39)		probably null	Het
Fbxw16	T	C	9: 109,275,625 (GRCm39)	I135V	probably benign	Het
Glipr1l1	A	T	10: 111,898,252 (GRCm39)	D119V	probably benign	Het
Gprc5b	G	A	7: 118,583,437 (GRCm39)	A144V	possibly damaging	Het
Lmbrd2	G	A	15: 9,165,882 (GRCm39)	R252H	possibly damaging	Het
Lyst	A	G	13: 13,809,472 (GRCm39)	T381A	probably damaging	Het
Mcpt4	A	T	14: 56,298,444 (GRCm39)	V97D	possibly damaging	Het
Nefh	A	G	11: 4,890,066 (GRCm39)	I851T	probably benign	Het
Nf1	A	T	11: 79,275,070 (GRCm39)	I44F	probably damaging	Het
Nyap2	A	T	1: 81,218,811 (GRCm39)	I278F	probably damaging	Het
Or4c52	A	T	2: 89,845,993 (GRCm39)	T240S	probably benign	Het
Or4f7d-ps1	G	T	2: 111,674,789 (GRCm39)		noncoding transcript	Het
Pdcd4	C	A	19: 53,908,092 (GRCm39)	P201Q	probably damaging	Het
Pramel16	A	T	4: 143,675,713 (GRCm39)	L371*	probably null	Het
Prdm11	T	C	2: 92,823,728 (GRCm39)	T179A	probably benign	Het
Qrfpr	T	A	3: 36,243,703 (GRCm39)	I133F	probably damaging	Het
Rack1	T	C	11: 48,692,453 (GRCm39)		probably benign	Het
Rrs1	C	T	1: 9,616,448 (GRCm39)	R234C	possibly damaging	Het
Sag	G	C	1: 87,772,737 (GRCm39)	D402H	probably benign	Het
Sbk3	T	A	7: 4,972,979 (GRCm39)	T64S	probably benign	Het
Setx	GTGGCT	GT	2: 29,044,073 (GRCm39)	1814	probably null	Het
Sh3gl1	C	T	17: 56,326,173 (GRCm39)	G111D	probably damaging	Het
Spata20	G	A	11: 94,373,914 (GRCm39)	R379W	probably damaging	Het
St3gal2	T	C	8: 111,688,991 (GRCm39)	M177T	probably benign	Het
Stk39	C	T	2: 68,221,284 (GRCm39)	G213D	probably damaging	Het
Szt2	A	G	4: 118,222,603 (GRCm39)		probably benign	Het
Taf1d	T	C	9: 15,219,939 (GRCm39)	S63P	probably damaging	Het
Tnfrsf13b	C	G	11: 61,031,643 (GRCm39)		probably null	Het
Ttn	G	T	2: 76,554,394 (GRCm39)	A30807D	probably damaging	Het
Unc119	A	G	11: 78,238,948 (GRCm39)	N158S	probably damaging	Het
Vmn2r116	T	A	17: 23,620,801 (GRCm39)	I845N	possibly damaging	Het
Vmn2r12	C	A	5: 109,239,830 (GRCm39)	M244I	probably benign	Het
Zdhhc4	A	G	5: 143,309,997 (GRCm39)	V87A	probably damaging	Het
Zwilch	A	G	9: 64,062,444 (GRCm39)		probably null	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,215,125 (GRCm39)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,250,007 (GRCm39)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,359,948 (GRCm39)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,265,378 (GRCm39)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,223,848 (GRCm39)	critical splice donor site	probably null
IGL00900:Reln	APN	5	22,185,115 (GRCm39)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	22,184,664 (GRCm39)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	22,191,965 (GRCm39)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	22,174,031 (GRCm39)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	22,124,067 (GRCm39)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,376,249 (GRCm39)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	22,174,077 (GRCm39)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	22,124,173 (GRCm39)	nonsense	probably null
IGL01361:Reln	APN	5	22,124,019 (GRCm39)	missense	probably benign	0.06
IGL01446:Reln	APN	5	22,174,315 (GRCm39)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,245,403 (GRCm39)	missense	probably benign	0.40
IGL01612:Reln	APN	5	22,101,928 (GRCm39)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	22,125,436 (GRCm39)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	22,152,512 (GRCm39)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,549,244 (GRCm39)	nonsense	probably null
IGL01875:Reln	APN	5	22,109,715 (GRCm39)	missense	probably benign
IGL02013:Reln	APN	5	22,155,877 (GRCm39)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	22,184,014 (GRCm39)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	22,114,956 (GRCm39)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	22,109,729 (GRCm39)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	22,115,990 (GRCm39)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,285,789 (GRCm39)	nonsense	probably null
IGL02408:Reln	APN	5	22,106,617 (GRCm39)	missense	probably benign	0.44
IGL02415:Reln	APN	5	22,176,949 (GRCm39)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,245,425 (GRCm39)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,239,750 (GRCm39)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,308,355 (GRCm39)	missense	probably benign	0.09
IGL02720:Reln	APN	5	22,202,939 (GRCm39)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	22,090,546 (GRCm39)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	22,200,363 (GRCm39)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	22,115,842 (GRCm39)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	22,115,834 (GRCm39)	missense	probably damaging	0.99
Fishing	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,311,058 (GRCm39)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	22,130,369 (GRCm39)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,209,134 (GRCm39)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,333,647 (GRCm39)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	22,153,447 (GRCm39)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0266:Reln	UTSW	5	22,193,774 (GRCm39)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,432,511 (GRCm39)	splice site	probably benign
R0333:Reln	UTSW	5	22,134,240 (GRCm39)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	22,155,820 (GRCm39)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,253,798 (GRCm39)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	22,125,494 (GRCm39)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	22,152,406 (GRCm39)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,256,274 (GRCm39)	splice site	probably benign
R0541:Reln	UTSW	5	22,185,107 (GRCm39)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,215,148 (GRCm39)	missense	probably benign	0.36
R0617:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,223,867 (GRCm39)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	22,118,228 (GRCm39)	missense	probably benign	0.44
R0704:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,432,626 (GRCm39)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,239,662 (GRCm39)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,239,773 (GRCm39)	missense	probably benign
R1163:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R1222:Reln	UTSW	5	22,191,953 (GRCm39)	missense	probably null	0.97
R1226:Reln	UTSW	5	22,115,864 (GRCm39)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,333,600 (GRCm39)	splice site	probably benign
R1532:Reln	UTSW	5	22,239,742 (GRCm39)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	22,165,376 (GRCm39)	missense	probably benign	0.01
R1565:Reln	UTSW	5	22,130,211 (GRCm39)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,265,366 (GRCm39)	missense	probably benign	0.01
R1636:Reln	UTSW	5	22,203,681 (GRCm39)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	22,134,084 (GRCm39)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	22,160,093 (GRCm39)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,215,287 (GRCm39)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	22,184,000 (GRCm39)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,249,960 (GRCm39)	critical splice donor site	probably null
R1991:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	22,147,625 (GRCm39)	missense	probably benign	0.01
R2072:Reln	UTSW	5	22,124,175 (GRCm39)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,223,998 (GRCm39)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	22,174,083 (GRCm39)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,253,003 (GRCm39)	missense	probably benign	0.30
R2219:Reln	UTSW	5	22,177,045 (GRCm39)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	22,192,076 (GRCm39)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	22,101,784 (GRCm39)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,359,954 (GRCm39)	missense	probably benign	0.00
R2321:Reln	UTSW	5	22,120,018 (GRCm39)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	22,184,688 (GRCm39)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,549,367 (GRCm39)	missense	unknown
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,245,418 (GRCm39)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	22,200,587 (GRCm39)	splice site	probably benign
R3713:Reln	UTSW	5	22,109,732 (GRCm39)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	22,153,564 (GRCm39)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	22,116,012 (GRCm39)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	22,115,847 (GRCm39)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	22,183,999 (GRCm39)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	22,200,364 (GRCm39)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,432,628 (GRCm39)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,333,630 (GRCm39)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,239,582 (GRCm39)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	22,106,741 (GRCm39)	missense	probably benign	0.44
R4615:Reln	UTSW	5	22,177,870 (GRCm39)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,357,461 (GRCm39)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	22,124,220 (GRCm39)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,254,698 (GRCm39)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,549,183 (GRCm39)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,223,844 (GRCm39)	splice site	probably null
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4896:Reln	UTSW	5	22,160,236 (GRCm39)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	22,184,718 (GRCm39)	missense	probably benign	0.02
R4912:Reln	UTSW	5	22,130,191 (GRCm39)	missense	probably benign	0.29
R4922:Reln	UTSW	5	22,200,585 (GRCm39)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	22,165,424 (GRCm39)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,239,636 (GRCm39)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	22,153,510 (GRCm39)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	22,101,075 (GRCm39)	missense	probably benign	0.00
R5119:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5125:Reln	UTSW	5	22,118,239 (GRCm39)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	22,153,627 (GRCm39)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	22,193,763 (GRCm39)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,308,395 (GRCm39)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,216,161 (GRCm39)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,244,527 (GRCm39)	missense	probably benign
R5400:Reln	UTSW	5	22,184,712 (GRCm39)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,209,201 (GRCm39)	missense	probably benign	0.00
R5514:Reln	UTSW	5	22,176,883 (GRCm39)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	22,137,713 (GRCm39)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,244,663 (GRCm39)	nonsense	probably null
R5648:Reln	UTSW	5	22,203,570 (GRCm39)	missense	probably benign	0.04
R5649:Reln	UTSW	5	22,106,623 (GRCm39)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,311,081 (GRCm39)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,223,054 (GRCm39)	missense	probably benign	0.01
R5815:Reln	UTSW	5	22,152,431 (GRCm39)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	22,104,111 (GRCm39)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	22,116,048 (GRCm39)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	22,153,594 (GRCm39)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,265,331 (GRCm39)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,491,942 (GRCm39)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,357,482 (GRCm39)	nonsense	probably null
R6351:Reln	UTSW	5	22,106,661 (GRCm39)	nonsense	probably null
R6369:Reln	UTSW	5	22,256,359 (GRCm39)	missense	probably benign	0.03
R6371:Reln	UTSW	5	22,200,511 (GRCm39)	missense	probably benign
R6374:Reln	UTSW	5	22,285,712 (GRCm39)	missense	probably benign	0.06
R6425:Reln	UTSW	5	22,116,018 (GRCm39)	nonsense	probably null
R6442:Reln	UTSW	5	22,137,774 (GRCm39)	missense	probably benign
R6445:Reln	UTSW	5	22,124,212 (GRCm39)	missense	probably benign	0.05
R6554:Reln	UTSW	5	22,101,838 (GRCm39)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	22,183,905 (GRCm39)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,239,568 (GRCm39)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	22,104,177 (GRCm39)	missense	probably benign	0.18
R6932:Reln	UTSW	5	22,190,855 (GRCm39)	missense	probably benign	0.00
R6948:Reln	UTSW	5	22,177,033 (GRCm39)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	22,181,562 (GRCm39)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	22,120,085 (GRCm39)	nonsense	probably null
R7091:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably null	0.08
R7135:Reln	UTSW	5	22,181,594 (GRCm39)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,311,095 (GRCm39)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	22,147,618 (GRCm39)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,252,945 (GRCm39)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	22,183,921 (GRCm39)	missense	probably benign	0.03
R7393:Reln	UTSW	5	22,181,349 (GRCm39)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,256,365 (GRCm39)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	22,176,932 (GRCm39)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	22,176,951 (GRCm39)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,308,433 (GRCm39)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	22,147,739 (GRCm39)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	22,134,125 (GRCm39)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,432,636 (GRCm39)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	22,181,276 (GRCm39)	nonsense	probably null
R7588:Reln	UTSW	5	22,090,566 (GRCm39)	missense	probably benign	0.03
R7631:Reln	UTSW	5	22,176,933 (GRCm39)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	22,183,929 (GRCm39)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,244,633 (GRCm39)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,339,690 (GRCm39)	missense	probably benign	0.00
R7938:Reln	UTSW	5	22,155,870 (GRCm39)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	22,104,082 (GRCm39)	nonsense	probably null
R8062:Reln	UTSW	5	22,176,990 (GRCm39)	missense	probably benign	0.00
R8222:Reln	UTSW	5	22,136,475 (GRCm39)	nonsense	probably null
R8266:Reln	UTSW	5	22,223,085 (GRCm39)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,209,110 (GRCm39)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,209,229 (GRCm39)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	22,147,672 (GRCm39)	missense	probably benign	0.37
R8801:Reln	UTSW	5	22,155,854 (GRCm39)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	22,130,257 (GRCm39)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	22,090,512 (GRCm39)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	22,104,155 (GRCm39)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	22,184,577 (GRCm39)	missense	probably benign	0.00
R9022:Reln	UTSW	5	22,181,613 (GRCm39)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,253,036 (GRCm39)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,216,059 (GRCm39)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	22,130,198 (GRCm39)	missense	probably benign	0.01
R9126:Reln	UTSW	5	22,160,194 (GRCm39)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	22,155,815 (GRCm39)	critical splice donor site	probably null
R9182:Reln	UTSW	5	22,106,617 (GRCm39)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,357,471 (GRCm39)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,549,200 (GRCm39)	nonsense	probably null
R9241:Reln	UTSW	5	22,174,067 (GRCm39)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	22,120,151 (GRCm39)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	22,153,545 (GRCm39)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,209,209 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,193,705 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,285,689 (GRCm39)	missense	probably benign	0.01
R9309:Reln	UTSW	5	22,176,866 (GRCm39)	missense	probably benign	0.37
R9338:Reln	UTSW	5	22,202,937 (GRCm39)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,549,202 (GRCm39)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	22,120,105 (GRCm39)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,549,198 (GRCm39)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	22,125,508 (GRCm39)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	22,136,427 (GRCm39)	missense	probably benign	0.26
R9745:Reln	UTSW	5	22,152,525 (GRCm39)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	22,155,943 (GRCm39)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	22,184,022 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,209,080 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,174,239 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,432,634 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,359,957 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGTGAGATCTTAGACGACCTGTATCC -3'
(R):5'- CTGTATACCTGTCAGTTAATATCCATG -3'

Sequencing Primer
(F):5'- AGACGACCTGTATCCTTCTGGTG -3'
(R):5'- CCTTGCTAAATCTATCATCCGA -3'

Posted On

2015-06-20