Incidental Mutation 'R4299:Nrbp1'
ID323475
Institutional Source Beutler Lab
Gene Symbol Nrbp1
Ensembl Gene ENSMUSG00000029148
Gene Namenuclear receptor binding protein 1
SynonymsB230344L17Rik, Nrbp
MMRRC Submission 041087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4299 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31240864-31251566 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31250599 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000041565] [ENSMUST00000054829] [ENSMUST00000201625] [ENSMUST00000201937] [ENSMUST00000202505] [ENSMUST00000202576]
Predicted Effect probably null
Transcript: ENSMUST00000031034
SMART Domains Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 324 5.8e-26 PFAM
Pfam:Pkinase 80 327 1e-26 PFAM
low complexity region 412 436 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041565
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000054829
SMART Domains Protein: ENSMUSP00000060414
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 211 8.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201565
Predicted Effect probably benign
Transcript: ENSMUST00000201625
SMART Domains Protein: ENSMUSP00000144052
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201697
Predicted Effect probably benign
Transcript: ENSMUST00000201937
SMART Domains Protein: ENSMUSP00000144464
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202384
Predicted Effect probably benign
Transcript: ENSMUST00000202505
SMART Domains Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
STYKc 14 184 1.3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202560
Predicted Effect probably null
Transcript: ENSMUST00000202576
SMART Domains Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202982
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,487,526 R208G possibly damaging Het
Abcc12 T C 8: 86,531,525 probably null Het
Akna A T 4: 63,398,032 D31E possibly damaging Het
Apbb2 A T 5: 66,313,378 H528Q probably damaging Het
Atp6v1g3 C A 1: 138,283,724 Y47* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
BC048403 C A 10: 121,745,446 H117Q probably benign Het
C4b T C 17: 34,731,144 D1384G possibly damaging Het
C87499 T C 4: 88,628,182 K137E probably damaging Het
Cbfa2t2 G A 2: 154,523,928 V353I probably damaging Het
Cdh7 T C 1: 110,061,001 I211T probably damaging Het
Cep170b T C 12: 112,739,305 S1166P probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs G A 16: 22,805,411 Q149* probably null Het
Cyp2c70 T C 19: 40,183,928 Q90R probably benign Het
Cyp3a41b T C 5: 145,573,677 Y129C possibly damaging Het
Dnah10 A G 5: 124,819,925 T3645A probably damaging Het
Dolk A T 2: 30,285,188 W282R probably damaging Het
Dsg2 T A 18: 20,595,951 probably null Het
Dysf A G 6: 84,068,077 T297A possibly damaging Het
Flt1 G T 5: 147,683,907 D142E probably benign Het
Frmd4a C A 2: 4,333,071 N29K probably benign Het
Fxyd7 A T 7: 31,044,982 M36K probably benign Het
Gabbr1 C T 17: 37,055,900 R178* probably null Het
Gm14139 G A 2: 150,190,733 D17N probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Il1rapl1 A T X: 87,300,707 I194N probably damaging Het
Klhl24 T C 16: 20,107,004 M94T probably damaging Het
Kmt2e T A 5: 23,464,914 I133N probably damaging Het
Macf1 A G 4: 123,399,406 I5381T probably damaging Het
Madd A G 2: 91,169,803 L197P probably damaging Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Micall2 T C 5: 139,709,471 probably benign Het
Myh9 T C 15: 77,769,964 T1214A probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Neurl4 A C 11: 69,909,061 D1055A probably damaging Het
Olfr1052 A T 2: 86,298,241 I142F possibly damaging Het
Olfr27 T C 9: 39,144,999 S300P probably benign Het
Olfr380 A T 11: 73,454,001 D70E probably damaging Het
Olfr421-ps1 T A 1: 174,152,312 Y265* probably null Het
Olfr53 T C 7: 140,652,243 V88A probably benign Het
Olfr67 T A 7: 103,787,995 H94L probably benign Het
Olfr901 T G 9: 38,430,812 Y177D probably damaging Het
Olfr933 T A 9: 38,975,759 F28I probably damaging Het
Patj C A 4: 98,677,321 N1090K possibly damaging Het
Pde8a A G 7: 81,328,035 D692G probably benign Het
Ppa2 G T 3: 133,367,842 K220N probably damaging Het
Rad54b A G 4: 11,597,865 H250R probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rgs14 A G 13: 55,383,753 T497A probably damaging Het
Rpl13-ps3 T A 14: 58,893,523 noncoding transcript Het
Scn11a T G 9: 119,765,506 I1274L probably damaging Het
Sco1 A T 11: 67,055,800 H133L possibly damaging Het
Slc4a8 T C 15: 100,796,640 probably null Het
Smc2 C T 4: 52,440,238 probably benign Het
Spata18 T C 5: 73,666,902 I156T probably benign Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stt3a A G 9: 36,763,344 F48L probably damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Telo2 A T 17: 25,115,256 S6T possibly damaging Het
Tnfrsf11b T C 15: 54,252,095 M369V probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Vmn1r234 A T 17: 21,229,021 M66L probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Wdfy2 T A 14: 62,925,140 L97* probably null Het
Wdr63 C T 3: 146,068,806 D429N probably damaging Het
Xrcc5 T C 1: 72,394,720 *733Q probably null Het
Zadh2 A T 18: 84,094,501 I101F possibly damaging Het
Zfp516 G A 18: 82,987,497 G842D possibly damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Nrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nrbp1 APN 5 31251059 missense possibly damaging 0.74
IGL00926:Nrbp1 APN 5 31243797 missense probably benign 0.07
Ghetto UTSW 5 31245846 critical splice donor site probably null
pudong UTSW 5 31250137 missense probably damaging 1.00
Shanghai UTSW 5 31245813 missense probably damaging 1.00
R0358:Nrbp1 UTSW 5 31244887 missense probably damaging 1.00
R0993:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1139:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1177:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1179:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1180:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1193:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1194:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1196:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1267:Nrbp1 UTSW 5 31250590 missense probably benign 0.00
R1302:Nrbp1 UTSW 5 31249889 missense probably benign 0.00
R1320:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1321:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1322:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1324:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1325:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1341:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1388:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1411:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1448:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1697:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1815:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1816:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1950:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1987:Nrbp1 UTSW 5 31245391 missense probably damaging 1.00
R2079:Nrbp1 UTSW 5 31251073 missense probably benign 0.08
R2142:Nrbp1 UTSW 5 31247929 missense possibly damaging 0.95
R5115:Nrbp1 UTSW 5 31243715 nonsense probably null
R5168:Nrbp1 UTSW 5 31250137 missense probably damaging 1.00
R5640:Nrbp1 UTSW 5 31249585 missense possibly damaging 0.96
R6765:Nrbp1 UTSW 5 31245846 critical splice donor site probably null
R7022:Nrbp1 UTSW 5 31244481 missense probably damaging 1.00
R7044:Nrbp1 UTSW 5 31249946 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGCCATGGGGATAGAGAC -3'
(R):5'- GGGATATGGCTCATAGATCCTCCC -3'

Sequencing Primer
(F):5'- AACTAAGGCACTGTCCTGTATGG -3'
(R):5'- GATCCTCCCTCCTCCAAAAGAAAGG -3'
Posted On2015-06-20